Transcript: Mouse NM_001081068.1

Mus musculus listerin E3 ubiquitin protein ligase 1 (Ltn1), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Ltn1 (78913)
Length:
7737
CDS:
140..5443

Additional Resources:

NCBI RefSeq record:
NM_001081068.1
NBCI Gene record:
Ltn1 (78913)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001081068.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000243461 GGACCGATGTTTGACCATTTA pLKO_005 1499 CDS 100% 13.200 18.480 N Ltn1 n/a
2 TRCN0000243458 TCCGAAACCAAGTAGCAATTT pLKO_005 7468 3UTR 100% 13.200 18.480 N Ltn1 n/a
3 TRCN0000243457 TTGATCCTTTCCCGAAGTATT pLKO_005 3419 CDS 100% 13.200 18.480 N Ltn1 n/a
4 TRCN0000243459 AGCTATTGCATGGCATATTAA pLKO_005 3687 CDS 100% 15.000 10.500 N Ltn1 n/a
5 TRCN0000243460 GCTATTGAGGTATCAAGTAAA pLKO_005 4730 CDS 100% 13.200 7.920 N Ltn1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001081068.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14105 pDONR223 99.9% 83.6% 85.2% None (many diffs) n/a
2 ccsbBroad304_14105 pLX_304 0% 83.6% 85.2% V5 (not translated due to frame shift) (many diffs) n/a
3 TRCN0000476521 CGAACTTACCCTCTGGCAGTGGTC pLX_317 8.2% 83.6% 85.2% V5 (not translated due to frame shift) (many diffs) n/a
Download CSV