Transcript: Mouse NM_001081073.1

Mus musculus centrosomal protein 76 (Cep76), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Cep76 (225659)
Length:
3979
CDS:
163..2142

Additional Resources:

NCBI RefSeq record:
NM_001081073.1
NBCI Gene record:
Cep76 (225659)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001081073.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000252465 CATAGATCTGACTGGTAATAT pLKO_005 2250 3UTR 100% 15.000 21.000 N Cep76 n/a
2 TRCN0000147582 GAACTAGAATGGCTGATTCAA pLKO.1 689 CDS 100% 5.625 7.875 N CEP76 n/a
3 TRCN0000252464 TGCAGAGAAAGAGCGATTATT pLKO_005 990 CDS 100% 15.000 12.000 N Cep76 n/a
4 TRCN0000414934 TGCAGAGAAAGAGCGATTATT pLKO_005 990 CDS 100% 15.000 12.000 N CEP76 n/a
5 TRCN0000252461 CAGGATGAGAATGGGATAAAT pLKO_005 1093 CDS 100% 15.000 10.500 N Cep76 n/a
6 TRCN0000252462 TCCAATTCACATGGTACTAAT pLKO_005 732 CDS 100% 13.200 9.240 N Cep76 n/a
7 TRCN0000252463 TTTGATAAGCAGTCAACATTA pLKO_005 430 CDS 100% 13.200 9.240 N Cep76 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001081073.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04152 pDONR223 100% 90.2% 97.7% None (many diffs) n/a
2 ccsbBroad304_04152 pLX_304 0% 90.2% 97.7% V5 (many diffs) n/a
3 TRCN0000477682 ACCATTGCAGGGAATCATGTTCTG pLX_317 22.5% 90.2% 97.7% V5 (many diffs) n/a
Download CSV