Transcript: Mouse NM_001081104.1

Mus musculus cholinergic receptor, nicotinic, alpha polypeptide 9 (Chrna9), mRNA.

Source:
NCBI, updated 2017-06-25
Taxon:
Mus musculus (mouse)
Gene:
Chrna9 (231252)
Length:
2003
CDS:
325..1764

Additional Resources:

NCBI RefSeq record:
NM_001081104.1
NBCI Gene record:
Chrna9 (231252)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001081104.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000253093 GTCACGCTCTCCCAGATAAAG pLKO_005 508 CDS 100% 13.200 18.480 N Chrna9 n/a
2 TRCN0000253092 TGTGGTGGATGTCACCTATTT pLKO_005 789 CDS 100% 13.200 9.240 N Chrna9 n/a
3 TRCN0000253091 TTGGTAGGCATTCGATATTTG pLKO_005 1785 3UTR 100% 13.200 9.240 N Chrna9 n/a
4 TRCN0000253094 TCATGACCGTCTTGATCATAG pLKO_005 1730 CDS 100% 10.800 7.560 N Chrna9 n/a
5 TRCN0000253090 TTGGTTCCTGGACCTACAATG pLKO_005 842 CDS 100% 10.800 7.560 N Chrna9 n/a
6 TRCN0000063396 GCCATGACTGTATTTCAGCTA pLKO.1 1156 CDS 100% 2.640 1.848 N CHRNA9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001081104.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08548 pDONR223 100% 85.4% 90.8% None (many diffs) n/a
2 ccsbBroad304_08548 pLX_304 0% 85.4% 90.8% V5 (many diffs) n/a
3 TRCN0000466141 GTACTTAGTCCGCCGTTTAACTCA pLX_317 25.5% 85.4% 90.8% V5 (many diffs) n/a
Download CSV