Transcript: Mouse NM_001081128.3

Mus musculus 5-methyltetrahydrofolate-homocysteine methyltransferase (Mtr), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Mtr (238505)
Length:
4487
CDS:
258..4019

Additional Resources:

NCBI RefSeq record:
NM_001081128.3
NBCI Gene record:
Mtr (238505)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001081128.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000251689 AGCTCTGGGTCCGACTAATAA pLKO_005 650 CDS 100% 15.000 12.000 N Mtr n/a
2 TRCN0000251687 GTATAACTCAGCCTGATATTA pLKO_005 430 CDS 100% 15.000 12.000 N Mtr n/a
3 TRCN0000251688 CCAGTGAAGCCCACGTTTATT pLKO_005 3069 CDS 100% 15.000 10.500 N Mtr n/a
4 TRCN0000424139 GTTTCTACCTCAGGTTATAAA pLKO_005 2405 CDS 100% 15.000 10.500 N MTR n/a
5 TRCN0000429125 CAGTGAAGCCCACGTTTATTG pLKO_005 3070 CDS 100% 13.200 9.240 N MTR n/a
6 TRCN0000251690 CTCACACTCCTTTACTCTTTC pLKO_005 4027 3UTR 100% 10.800 7.560 N Mtr n/a
7 TRCN0000251686 TGGACCACAAAGCAGATATAA pLKO_005 2680 CDS 100% 15.000 9.000 N Mtr n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001081128.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13904 pDONR223 100% 87.3% 34.9% None (many diffs) n/a
2 ccsbBroad304_13904 pLX_304 0% 87.3% 34.9% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000481034 TCTCGTACTTCTAGTCTTGCAGTC pLX_317 11.2% 87.3% 34.9% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV