Transcript: Mouse NM_001081146.2

Mus musculus prickle planar cell polarity protein 2 (Prickle2), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Prickle2 (243548)
Length:
7799
CDS:
40..2745

Additional Resources:

NCBI RefSeq record:
NM_001081146.2
NBCI Gene record:
Prickle2 (243548)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001081146.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000452902 CAAGGTGGAGTGGCCATTAAC pLKO_005 3003 3UTR 100% 13.200 18.480 N Prickle2 n/a
2 TRCN0000442592 CTACTTCACGGAGTATGATTG pLKO_005 2511 CDS 100% 10.800 15.120 N Prickle2 n/a
3 TRCN0000440572 TCATTGTAAATGCGATGTAAA pLKO_005 3139 3UTR 100% 13.200 9.240 N Prickle2 n/a
4 TRCN0000091050 CCCTAAGAGAAGCTCATCAAT pLKO.1 1551 CDS 100% 5.625 3.938 N Prickle2 n/a
5 TRCN0000091049 CCTGCACAAATACAGCTCTTA pLKO.1 2637 CDS 100% 4.950 3.465 N Prickle2 n/a
6 TRCN0000091048 GCTAAGAATGTAAACTCAGAA pLKO.1 2779 3UTR 100% 4.950 3.465 N Prickle2 n/a
7 TRCN0000091051 GCTCATTGTAAGAAGTCTCTT pLKO.1 1063 CDS 100% 4.950 3.465 N Prickle2 n/a
8 TRCN0000091052 CATGACAATGAGGTTCGGTAT pLKO.1 454 CDS 100% 4.050 2.835 N Prickle2 n/a
9 TRCN0000138934 GAAGAGGAGGAGGAAGAAGAA pLKO.1 1723 CDS 100% 4.950 2.475 Y PTMA n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001081146.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.