Transcript: Mouse NM_001081151.1

Mus musculus giant axonal neuropathy (Gan), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Gan (209239)
Length:
2652
CDS:
1..1794

Additional Resources:

NCBI RefSeq record:
NM_001081151.1
NBCI Gene record:
Gan (209239)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001081151.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000251144 AGTGGGCAGATCAGGTTAAAT pLKO_005 274 CDS 100% 15.000 21.000 N Gan n/a
2 TRCN0000251145 ACGACTACGTGCGGGAGTTTA pLKO_005 1622 CDS 100% 13.200 18.480 N Gan n/a
3 TRCN0000083859 CCCGTACATCAGGACAAAGTT pLKO.1 156 CDS 100% 5.625 7.875 N GAN n/a
4 TRCN0000251146 GCAGTTAGTTCCCACTTATTA pLKO_005 2278 3UTR 100% 15.000 10.500 N Gan n/a
5 TRCN0000251143 TGGCGATCGAGAGCTCATTTC pLKO_005 1149 CDS 100% 10.800 7.560 N Gan n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001081151.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01867 pDONR223 100% 87.5% 98.3% None (many diffs) n/a
2 ccsbBroad304_01867 pLX_304 0% 87.5% 98.3% V5 (many diffs) n/a
3 TRCN0000470166 CCCCCACCTCTATGAGGGGTTTAC pLX_317 23.4% 87.5% 98.3% V5 (many diffs) n/a
Download CSV