Transcript: Mouse NM_001081166.2

Mus musculus PHD finger protein 21B (Phf21b), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Phf21b (271305)
Length:
3755
CDS:
412..1875

Additional Resources:

NCBI RefSeq record:
NM_001081166.2
NBCI Gene record:
Phf21b (271305)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001081166.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000368606 CTGTCGGCCTTAATTCATAAA pLKO_005 1940 3UTR 100% 13.200 18.480 N PHF21B n/a
2 TRCN0000239041 TGGTTACGCGGTGCCGATTAT pLKO_005 3407 3UTR 100% 13.200 18.480 N Phf21b n/a
3 TRCN0000239038 CAGATGCTTCAGGTCGCTATG pLKO_005 1753 CDS 100% 6.000 8.400 N Phf21b n/a
4 TRCN0000239040 TCACCCACAAGACAGTGAAAG pLKO_005 1535 CDS 100% 10.800 7.560 N Phf21b n/a
5 TRCN0000022041 GTTAGGCCAAAGACTCTGATT pLKO.1 625 CDS 100% 4.950 3.465 N PHF21B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001081166.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09382 pDONR223 100% 80.4% 80.8% None (many diffs) n/a
2 ccsbBroad304_09382 pLX_304 0% 80.4% 80.8% V5 (many diffs) n/a
3 TRCN0000472632 TTTAAACCGTCACATTTAAGTGAC pLX_317 29.6% 80.4% 80.8% V5 (many diffs) n/a
Download CSV