Transcript: Mouse NM_001081328.1

Mus musculus chondroitin sulfate synthase 3 (Chsy3), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Chsy3 (78923)
Length:
3882
CDS:
338..2992

Additional Resources:

NCBI RefSeq record:
NM_001081328.1
NBCI Gene record:
Chsy3 (78923)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001081328.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000440440 ATTTGGGTGTCAGGGATAATC pLKO_005 2958 CDS 100% 13.200 10.560 N Chsy3 n/a
2 TRCN0000453007 CACAGTCATTCTCCGTTATAT pLKO_005 2115 CDS 100% 15.000 10.500 N Chsy3 n/a
3 TRCN0000162547 CTTGGACCCTAAGCAGTATAA pLKO.1 2866 CDS 100% 13.200 9.240 N CHSY3 n/a
4 TRCN0000452148 TCGTTGGAAGGTACGACATTT pLKO_005 2223 CDS 100% 13.200 9.240 N Chsy3 n/a
5 TRCN0000094035 CGACCACTATCTGGACAAGTA pLKO.1 1084 CDS 100% 4.950 3.465 N Chsy3 n/a
6 TRCN0000094036 CGACGACGATGTCTACATCAA pLKO.1 1123 CDS 100% 4.950 3.465 N Chsy3 n/a
7 TRCN0000158698 GACTTCAAGGAAATTCAGTAT pLKO.1 1895 CDS 100% 4.950 3.465 N CHSY3 n/a
8 TRCN0000094038 GTCCTTCATGATGATCAAGTA pLKO.1 1057 CDS 100% 4.950 3.465 N Chsy3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001081328.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05426 pDONR223 100% 87% 91.2% None (many diffs) n/a
2 ccsbBroad304_05426 pLX_304 0% 87% 91.2% V5 (many diffs) n/a
3 TRCN0000475886 CTGCCCGACCATCTTTTATCCTTC pLX_317 14.1% 87% 91.2% V5 (many diffs) n/a
Download CSV