Transcript: Mouse NM_001081345.2

Mus musculus chromodomain helicase DNA binding protein 2 (Chd2), mRNA.

Source:
NCBI, updated 2017-04-15
Taxon:
Mus musculus (mouse)
Gene:
Chd2 (244059)
Length:
9071
CDS:
573..6056

Additional Resources:

NCBI RefSeq record:
NM_001081345.2
NBCI Gene record:
Chd2 (244059)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001081345.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000239015 CAAGAACCATCACGATTTAAT pLKO_005 921 CDS 100% 15.000 21.000 N Chd2 n/a
2 TRCN0000239016 CGGATTCGCAGTTCCACTAAA pLKO_005 3786 CDS 100% 13.200 18.480 N Chd2 n/a
3 TRCN0000218567 TCATCCAGGCAGTACTATTAA pLKO_005 7581 3UTR 100% 15.000 12.000 N Chd2 n/a
4 TRCN0000239018 CTACCAGTGGAGACGGATAAA pLKO_005 4461 CDS 100% 13.200 10.560 N Chd2 n/a
5 TRCN0000239017 AGACCGTGCTGGGCAGTATTA pLKO_005 2380 CDS 100% 13.200 9.240 N Chd2 n/a
6 TRCN0000236470 AGGTTCATCAAGGCTTATAAG pLKO_005 3984 CDS 100% 13.200 9.240 N CHD2 n/a
7 TRCN0000021335 GCCTCTAAGAAGGAACGGATA pLKO.1 831 CDS 100% 4.050 2.835 N CHD2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001081345.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00301 pDONR223 100% 24.8% 26.2% None (many diffs) n/a
2 ccsbBroad304_00301 pLX_304 0% 24.8% 26.2% V5 (many diffs) n/a
3 TRCN0000466626 GAGAGAACCATGAACGTTGCGATT pLX_317 23.9% 24.8% 26.2% V5 (many diffs) n/a
Download CSV