Transcript: Mouse NM_001081411.1

Mus musculus sodium channel and clathrin linker 1 (Sclt1), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Sclt1 (67161)
Length:
3020
CDS:
487..2553

Additional Resources:

NCBI RefSeq record:
NM_001081411.1
NBCI Gene record:
Sclt1 (67161)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001081411.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000120661 CAGCAGTTACAATCTAGTATA pLKO.1 1318 CDS 100% 13.200 18.480 N Sclt1 n/a
2 TRCN0000440715 AGCTGTTGTACCAAACGTATT pLKO_005 2594 3UTR 100% 10.800 15.120 N Sclt1 n/a
3 TRCN0000454022 GTCAAATTGATCGAGCCATTA pLKO_005 1724 CDS 100% 10.800 15.120 N Sclt1 n/a
4 TRCN0000120658 GCAGCATCAAATCGAACATAT pLKO.1 546 CDS 100% 13.200 9.240 N Sclt1 n/a
5 TRCN0000414063 CAGACTTCAAAGGCGTCTAAG pLKO_005 2433 CDS 100% 10.800 7.560 N SCLT1 n/a
6 TRCN0000120659 CCTCCTCTCATTGCTGAGTAT pLKO.1 655 CDS 100% 4.950 3.465 N Sclt1 n/a
7 TRCN0000120657 GCAGCTATCAAAGCAAGGAAA pLKO.1 1609 CDS 100% 4.950 3.465 N Sclt1 n/a
8 TRCN0000120660 GCCAGATTAGATCTGAGAGTT pLKO.1 1177 CDS 100% 4.950 3.465 N Sclt1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001081411.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.