Transcript: Human NM_001081492.2

Homo sapiens keratin 80 (KRT80), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
KRT80 (144501)
Length:
3908
CDS:
113..1381

Additional Resources:

NCBI RefSeq record:
NM_001081492.2
NBCI Gene record:
KRT80 (144501)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001081492.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000416750 CTGATGGGTGAGTCGGAATTA pLKO_005 1764 3UTR 100% 13.200 18.480 N KRT80 n/a
2 TRCN0000416243 GGGCATCTCTATGAGGAATAT pLKO_005 497 CDS 100% 13.200 9.240 N KRT80 n/a
3 TRCN0000425392 CTTAAGCTAGACTCAAGAAAG pLKO_005 1556 3UTR 100% 10.800 7.560 N KRT80 n/a
4 TRCN0000116583 GACATGGAGTTCACCTTTGTT pLKO.1 650 CDS 100% 5.625 3.938 N KRT80 n/a
5 TRCN0000116582 CCCTTCCTGTTTCTGCATGAT pLKO.1 3232 3UTR 100% 4.950 3.465 N KRT80 n/a
6 TRCN0000116586 CGAAATGTCAGAGAAGTACTT pLKO.1 1458 3UTR 100% 4.950 3.465 N KRT80 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001081492.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09612 pDONR223 100% 99.8% 100% None 1113C>T;1254C>A n/a
2 ccsbBroad304_09612 pLX_304 0% 99.8% 100% V5 1113C>T;1254C>A n/a
3 TRCN0000491718 ACGGCCATTACGTGCGTGGGATGC pLX_317 31.3% 99.8% 100% V5 1113C>T;1254C>A n/a
Download CSV