Transcript: Human NM_001081955.3

Homo sapiens regulator of G protein signaling 9 (RGS9), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-02
Taxon:
Homo sapiens (human)
Gene:
RGS9 (8787)
Length:
2483
CDS:
172..2187

Additional Resources:

NCBI RefSeq record:
NM_001081955.3
NBCI Gene record:
RGS9 (8787)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001081955.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000435652 CTATCTGGCCAAGCGAAATAT pLKO_005 540 CDS 100% 15.000 21.000 N RGS9 n/a
2 TRCN0000014329 GCTGCCACGATTGAAATCCAA pLKO.1 2022 CDS 100% 3.000 4.200 N RGS9 n/a
3 TRCN0000433201 CAGATTTCAGACACCGTATTT pLKO_005 474 CDS 100% 13.200 9.240 N RGS9 n/a
4 TRCN0000433776 GCCTTCAACTTCAGCGAATTG pLKO_005 1060 CDS 100% 10.800 7.560 N RGS9 n/a
5 TRCN0000014328 CAAAGTGCATTTGGGTGACAT pLKO.1 2280 3UTR 100% 4.950 3.465 N RGS9 n/a
6 TRCN0000014331 TGGATCAACATAGATGGCAAA pLKO.1 1255 CDS 100% 4.050 2.835 N RGS9 n/a
7 TRCN0000014330 GAAGGATTCTTATGCTCGCTA pLKO.1 1362 CDS 100% 2.640 1.848 N RGS9 n/a
8 TRCN0000014332 GTTCTCATCCAACGATGCCAT pLKO.1 930 CDS 100% 2.640 1.848 N RGS9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001081955.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11303 pDONR223 100% 92.5% 92.5% None 1_147del;357C>G;826C>A n/a
2 ccsbBroad304_11303 pLX_304 0% 92.5% 92.5% V5 1_147del;357C>G;826C>A n/a
3 TRCN0000479277 TTGTGGGATGGCGTGAGGCGCAGA pLX_317 15.3% 92.5% 92.5% V5 1_147del;357C>G;826C>A n/a
Download CSV