Transcript: Human NM_001081976.2

Homo sapiens transmembrane and immunoglobulin domain containing 3 (TMIGD3), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Homo sapiens (human)
Gene:
TMIGD3 (57413)
Length:
1213
CDS:
52..852

Additional Resources:

NCBI RefSeq record:
NM_001081976.2
NBCI Gene record:
TMIGD3 (57413)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001081976.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000078085 CCGTGACTACTGCAACATCAT pLKO.1 384 CDS 100% 4.950 6.930 N TMIGD3 n/a
2 TRCN0000078086 CTGCAACTACAATGCCCACTA pLKO.1 327 CDS 100% 4.050 3.240 N TMIGD3 n/a
3 TRCN0000078084 GCTGATTGTAACTGACGACAA pLKO.1 558 CDS 100% 4.050 2.835 N TMIGD3 n/a
4 TRCN0000078087 CTCCAAAGGAAATGGCTCCTA pLKO.1 818 CDS 100% 2.640 1.848 N TMIGD3 n/a
5 TRCN0000078083 CCCTCTATCCTTGACAACAAT pLKO.1 964 3UTR 100% 5.625 3.375 N TMIGD3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001081976.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10672 pDONR223 100% 78.1% 78.1% None 1_174del n/a
2 ccsbBroad304_10672 pLX_304 0% 78.1% 78.1% V5 1_174del n/a
3 TRCN0000475109 CGATTTCACAGTTGGAACTCATTG pLX_317 65.2% 78.1% 78.1% V5 1_174del n/a
Download CSV