Transcript: Mouse NM_001083119.2

Mus musculus protein tyrosine phosphatase, receptor type, U (Ptpru), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Ptpru (19273)
Length:
5528
CDS:
123..4463

Additional Resources:

NCBI RefSeq record:
NM_001083119.2
NBCI Gene record:
Ptpru (19273)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001083119.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000220448 GCCTGAGATGATCTACGATTT pLKO.1 3017 CDS 100% 10.800 15.120 N Ptpru n/a
2 TRCN0000220110 CAGCTTTGATTATGCCGACAT pLKO.1 1892 CDS 100% 4.050 5.670 N PTPRU n/a
3 TRCN0000220451 CGTCATGCTGAACCAACTTAA pLKO.1 3941 CDS 100% 13.200 9.240 N Ptpru n/a
4 TRCN0000220450 CCAGGAGAAGACTCACATGAT pLKO.1 2510 CDS 100% 4.950 3.465 N Ptpru n/a
5 TRCN0000220449 CGTGCGTCTGATTCTCACAAA pLKO.1 1502 CDS 100% 4.950 3.465 N Ptpru n/a
6 TRCN0000029965 GCTCAGTATGACGACTTCCAA pLKO.1 252 CDS 100% 3.000 2.100 N Ptpru n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001083119.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07547 pDONR223 100% 88.2% 94.4% None (many diffs) n/a
2 ccsbBroad304_07547 pLX_304 0% 88.2% 94.4% V5 (many diffs) n/a
Download CSV