Transcript: Human NM_001083335.2

Homo sapiens zinc finger protein 112 (ZNF112), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
ZNF112 (7771)
Length:
3709
CDS:
90..2831

Additional Resources:

NCBI RefSeq record:
NM_001083335.2
NBCI Gene record:
ZNF112 (7771)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001083335.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000013092 CGAAGACTATGGTAAGGACTA pLKO.1 2762 CDS 100% 4.050 3.240 N ZNF112 n/a
2 TRCN0000230729 CACTAAGGAACAACCATATAA pLKO_005 1484 CDS 100% 15.000 10.500 N ZNF112 n/a
3 TRCN0000230727 TAGGGAATGGCTCCAATTATA pLKO_005 574 CDS 100% 15.000 10.500 N ZNF112 n/a
4 TRCN0000230730 AGTGATGAGCATGCCTAAATC pLKO_005 3077 3UTR 100% 13.200 9.240 N ZNF112 n/a
5 TRCN0000218258 CATTCAGCATAGGGTTCATAT pLKO_005 1382 CDS 100% 13.200 9.240 N ZNF112 n/a
6 TRCN0000013090 CCATGCAAATGTGGTGAATAT pLKO.1 1077 CDS 100% 13.200 9.240 N ZNF112 n/a
7 TRCN0000013088 CCCAACTTCAACATTCATAAT pLKO.1 2920 3UTR 100% 13.200 9.240 N ZNF112 n/a
8 TRCN0000013091 CCTATCCATGTACTGGGTATA pLKO.1 859 CDS 100% 10.800 7.560 N ZNF112 n/a
9 TRCN0000013089 GCGAGGAATGTGATAAGGGAT pLKO.1 1753 CDS 100% 2.640 1.848 N ZNF112 n/a
10 TRCN0000230728 AGTCATAGCTTAGACCTTAAT pLKO_005 1194 CDS 100% 13.200 7.920 N ZNF112 n/a
11 TRCN0000239543 ACAGGAGAGAAACCTTATAAA pLKO_005 1731 CDS 100% 15.000 7.500 Y Gm13212 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001083335.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07178 pDONR223 100% 99% 98.9% None (many diffs) n/a
2 ccsbBroad304_07178 pLX_304 0% 99% 98.9% V5 (many diffs) n/a
3 TRCN0000469888 CACTCAGCCATGGAGTGCTACGCC pLX_317 18.4% 99% 98.9% V5 (many diffs) n/a
Download CSV