Transcript: Human NM_001083602.2

Homo sapiens patched 1 (PTCH1), transcript variant 1a, mRNA.

Source:
NCBI, updated 2019-07-26
Taxon:
Homo sapiens (human)
Gene:
PTCH1 (5727)
Length:
8153
CDS:
587..4732

Additional Resources:

NCBI RefSeq record:
NM_001083602.2
NBCI Gene record:
PTCH1 (5727)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001083602.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000235518 AGTGGATATTCATGCGATTAT pLKO_005 7546 3UTR 100% 13.200 18.480 N PTCH1 n/a
2 TRCN0000010498 GATCTGAGTTCGACTTCATTG pLKO.1 3813 CDS 100% 10.800 15.120 N PTCH1 n/a
3 TRCN0000040052 GCGAAGTTTCAGAGACTCTTA pLKO.1 629 CDS 100% 4.950 6.930 N PTCH1 n/a
4 TRCN0000040049 CCTGTGCTCATTGATCGGAAT pLKO.1 1846 CDS 100% 4.050 5.670 N PTCH1 n/a
5 TRCN0000235517 ACACCGACACACACGACAATA pLKO_005 2277 CDS 100% 13.200 9.240 N PTCH1 n/a
6 TRCN0000235520 GACATCAGCCAGTTGACTAAA pLKO_005 3080 CDS 100% 13.200 9.240 N PTCH1 n/a
7 TRCN0000235521 GGACGAGTAAGTCGTGAATTA pLKO_005 788 CDS 100% 13.200 9.240 N PTCH1 n/a
8 TRCN0000040050 CCTCTTGATATGGCCCTTGTT pLKO.1 1334 CDS 100% 4.950 3.465 N PTCH1 n/a
9 TRCN0000040051 GCCTGAAACAAGGCTGAGAAT pLKO.1 3256 CDS 100% 4.950 3.465 N PTCH1 n/a
10 TRCN0000010497 TAATCCTCAACTCATGATACA pLKO.1 847 CDS 100% 4.950 3.465 N PTCH1 n/a
11 TRCN0000040048 CCCTGATTTCTGCATGGTGTA pLKO.1 6845 3UTR 100% 4.050 2.835 N PTCH1 n/a
12 TRCN0000042540 CCTGCAATTCTCAGCATGGAT pLKO.1 2165 CDS 100% 3.000 2.100 N Ptch1 n/a
13 TRCN0000326195 CCTGCAATTCTCAGCATGGAT pLKO_005 2165 CDS 100% 3.000 2.100 N Ptch1 n/a
14 TRCN0000235519 CTCCAACTGAGGGTGATTAAA pLKO_005 4723 CDS 100% 15.000 7.500 Y PTCH1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001083602.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11068 pDONR223 100% 13.2% 13.2% None 549_4143delinsG n/a
2 ccsbBroad304_11068 pLX_304 0% 13.2% 13.2% V5 549_4143delinsG n/a
3 TRCN0000473481 CACGTATCTTCGTGGCCCGCGTTC pLX_317 74.6% 13.2% 13.2% V5 549_4143delinsG n/a
Download CSV