Transcript: Mouse NM_001083958.1

Mus musculus zinc finger protein 655 (Zfp655), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-04-29
Taxon:
Mus musculus (mouse)
Gene:
Zfp655 (72611)
Length:
1765
CDS:
144..689

Additional Resources:

NCBI RefSeq record:
NM_001083958.1
NBCI Gene record:
Zfp655 (72611)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001083958.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000095626 CCTTTGGAGAACCAGTCTGAA pLKO.1 198 CDS 100% 4.950 3.960 N Zfp655 n/a
2 TRCN0000016687 CCAGGAGTTTGTGACATTCGA pLKO.1 362 CDS 100% 3.000 2.100 N ZNF655 n/a
3 TRCN0000280578 CCAGGAGTTTGTGACATTCGA pLKO_005 362 CDS 100% 3.000 2.100 N ZNF655 n/a
4 TRCN0000016684 CAAGTGCTTTCTCTGGAGAAA pLKO.1 565 CDS 100% 0.495 0.347 N ZNF655 n/a
5 TRCN0000280638 CAAGTGCTTTCTCTGGAGAAA pLKO_005 565 CDS 100% 0.495 0.347 N ZNF655 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001083958.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15977 pDONR223 0% 91.5% 85.6% None (many diffs) n/a
2 ccsbBroad304_15977 pLX_304 0% 91.5% 85.6% V5 (many diffs) n/a
Download CSV