Transcript: Human NM_001083963.1

Homo sapiens tudor and KH domain containing (TDRKH), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-03
Taxon:
Homo sapiens (human)
Gene:
TDRKH (11022)
Length:
2829
CDS:
158..1843

Additional Resources:

NCBI RefSeq record:
NM_001083963.1
NBCI Gene record:
TDRKH (11022)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001083963.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000230649 GGCGAGACAATTCGTTCTATC pLKO_005 587 CDS 100% 10.800 15.120 N TDRKH n/a
2 TRCN0000218001 GTACACAAAGGATACGCAATT pLKO_005 1616 CDS 100% 10.800 15.120 N TDRKH n/a
3 TRCN0000230648 GCCGGCAAGGAGCCAATATTA pLKO_005 363 CDS 100% 15.000 10.500 N TDRKH n/a
4 TRCN0000218287 ACCTTGAAGATGACTACTTAC pLKO_005 1818 CDS 100% 10.800 7.560 N TDRKH n/a
5 TRCN0000184470 GCTTCCATGTCTGGTGATGAT pLKO.1 1796 CDS 100% 4.950 3.465 N TDRKH n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001083963.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07728 pDONR223 100% 99.8% 99.6% None 61C>T;770G>C n/a
2 ccsbBroad304_07728 pLX_304 0% 99.8% 99.6% V5 61C>T;770G>C n/a
3 TRCN0000477584 GACGGACCTTACCTGACTGCAGCA pLX_317 22.7% 99.8% 99.6% V5 61C>T;770G>C n/a
Download CSV