Transcript: Human NM_001085367.1

Homo sapiens zinc finger protein 655 (ZNF655), transcript variant 10, mRNA.

Source:
NCBI, updated 2018-06-23
Taxon:
Homo sapiens (human)
Gene:
ZNF655 (79027)
Length:
1435
CDS:
221..766

Additional Resources:

NCBI RefSeq record:
NM_001085367.1
NBCI Gene record:
ZNF655 (79027)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001085367.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000016685 TGCACCTTACTCGAGAGGAAT pLKO.1 471 CDS 100% 0.000 0.000 N ZNF655 n/a
2 TRCN0000280577 TGCACCTTACTCGAGAGGAAT pLKO_005 471 CDS 100% 0.000 0.000 N ZNF655 n/a
3 TRCN0000016686 CAGCAGGAATCTCCAAGAGAT pLKO.1 678 CDS 100% 4.950 3.465 N ZNF655 n/a
4 TRCN0000297873 CAGCAGGAATCTCCAAGAGAT pLKO_005 678 CDS 100% 4.950 3.465 N ZNF655 n/a
5 TRCN0000016687 CCAGGAGTTTGTGACATTCGA pLKO.1 439 CDS 100% 3.000 2.100 N ZNF655 n/a
6 TRCN0000280578 CCAGGAGTTTGTGACATTCGA pLKO_005 439 CDS 100% 3.000 2.100 N ZNF655 n/a
7 TRCN0000016684 CAAGTGCTTTCTCTGGAGAAA pLKO.1 642 CDS 100% 0.495 0.347 N ZNF655 n/a
8 TRCN0000280638 CAAGTGCTTTCTCTGGAGAAA pLKO_005 642 CDS 100% 0.495 0.347 N ZNF655 n/a
9 TRCN0000016683 CCCGGATTCATAGTGTGAATT pLKO.1 594 CDS 100% 0.000 0.000 N ZNF655 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001085367.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15977 pDONR223 0% 100% 100% None n/a
2 ccsbBroad304_15977 pLX_304 0% 100% 100% V5 n/a
Download CSV