Transcript: Mouse NM_001085440.1

Mus musculus Smith-Magenis syndrome chromosome region, candidate 8 homolog (human) (Smcr8), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Smcr8 (237782)
Length:
7394
CDS:
504..3311

Additional Resources:

NCBI RefSeq record:
NM_001085440.1
NBCI Gene record:
Smcr8 (237782)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001085440.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000413852 CATCATCGAACATCAAGATTT pLKO_005 1229 CDS 100% 13.200 18.480 N Smcr8 n/a
2 TRCN0000431316 GAAGCTTATTGGCCTACAAAG pLKO_005 2837 CDS 100% 10.800 15.120 N Smcr8 n/a
3 TRCN0000418501 TTACTTCTCTTTGCGGATTAT pLKO_005 767 CDS 100% 13.200 10.560 N Smcr8 n/a
4 TRCN0000189565 CCCGAGACAACAGTTGTGAAA pLKO.1 2413 CDS 100% 4.950 3.960 N Smcr8 n/a
5 TRCN0000417485 CCCATTCCTAAAGTGTTAATT pLKO_005 1719 CDS 100% 15.000 10.500 N Smcr8 n/a
6 TRCN0000419322 CAAGAGCTCTCGGCCGAATTT pLKO_005 1011 CDS 100% 13.200 9.240 N Smcr8 n/a
7 TRCN0000130703 CCAGAAGAAAGCCAACGACAA pLKO.1 1148 CDS 100% 4.050 2.430 N SMCR8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001085440.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09595 pDONR223 100% 85.8% 89.5% None (many diffs) n/a
2 ccsbBroad304_09595 pLX_304 0% 85.8% 89.5% V5 (many diffs) n/a
3 TRCN0000475686 CCTTTATTCTAGGCGGACCCGCAT pLX_317 9.2% 85.8% 89.5% V5 (many diffs) n/a
Download CSV