Transcript: Human NM_001085471.2

Homo sapiens forkhead box N3 (FOXN3), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
FOXN3 (1112)
Length:
7862
CDS:
153..1625

Additional Resources:

NCBI RefSeq record:
NM_001085471.2
NBCI Gene record:
FOXN3 (1112)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001085471.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000013703 GCAGGGATGTCAACGTCAATA pLKO.1 1961 3UTR 100% 13.200 18.480 N FOXN3 n/a
2 TRCN0000013704 CCGGTCCTGTTTGAATAACAT pLKO.1 1550 CDS 100% 5.625 7.875 N FOXN3 n/a
3 TRCN0000235679 GATCCGGTCCTGTTTGAATAA pLKO_005 1547 CDS 100% 13.200 10.560 N FOXN3 n/a
4 TRCN0000086629 CAGTACCTTCTTCAAGAGAAA pLKO.1 860 CDS 100% 4.950 3.960 N Foxn3 n/a
5 TRCN0000235681 TCCTTCAGCTGCCTCATATTT pLKO_005 504 CDS 100% 15.000 10.500 N FOXN3 n/a
6 TRCN0000235677 TCGATATGGTGAACCTATTAA pLKO_005 7050 3UTR 100% 15.000 10.500 N FOXN3 n/a
7 TRCN0000013707 CAACTGGATCTTGGAACATTT pLKO.1 575 CDS 100% 13.200 9.240 N FOXN3 n/a
8 TRCN0000235680 CACACCCACACGTGTTCAATA pLKO_005 781 CDS 100% 13.200 9.240 N FOXN3 n/a
9 TRCN0000235678 CTCTGCCTGACATCCGATTAG pLKO_005 283 CDS 100% 10.800 7.560 N FOXN3 n/a
10 TRCN0000013705 CCCTGAGATACAAGCAGGTTT pLKO.1 944 CDS 100% 4.950 3.465 N FOXN3 n/a
11 TRCN0000013706 CCACTATGAGTTTGCCACCAA pLKO.1 1244 CDS 100% 2.640 1.848 N FOXN3 n/a
12 TRCN0000166364 CACACACACACACACACACAA pLKO.1 2442 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001085471.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00302 pDONR223 100% 95.5% 95.3% None 746_811del n/a
2 ccsbBroad304_00302 pLX_304 0% 95.5% 95.3% V5 746_811del n/a
3 TRCN0000478836 AGGGATCATCGGATTTCCATGCCT pLX_317 25.7% 95.5% 95.3% V5 746_811del n/a
Download CSV