Transcript: Human NM_001089.3

Homo sapiens ATP binding cassette subfamily A member 3 (ABCA3), mRNA.

Source:
NCBI, updated 2019-09-16
Taxon:
Homo sapiens (human)
Gene:
ABCA3 (21)
Length:
6602
CDS:
695..5809

Additional Resources:

NCBI RefSeq record:
NM_001089.3
NBCI Gene record:
ABCA3 (21)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001089.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000059342 GTTCAGTTACACACGGAGAAA pLKO.1 1159 CDS 100% 4.950 6.930 N ABCA3 n/a
2 TRCN0000315713 GTTCAGTTACACACGGAGAAA pLKO_005 1159 CDS 100% 4.950 6.930 N ABCA3 n/a
3 TRCN0000059338 GCTTGAAGATTCAGTCGGAAA pLKO.1 822 CDS 100% 4.050 5.670 N ABCA3 n/a
4 TRCN0000315649 GCTTGAAGATTCAGTCGGAAA pLKO_005 822 CDS 100% 4.050 5.670 N ABCA3 n/a
5 TRCN0000059341 GCATACATCAGCGGGTATGAA pLKO.1 2462 CDS 100% 0.563 0.788 N ABCA3 n/a
6 TRCN0000059339 GCCCAGCTCATTGGGAAATTT pLKO.1 1949 CDS 100% 15.000 12.000 N ABCA3 n/a
7 TRCN0000303547 CATCCTCTCTCTCCAAGTTTA pLKO_005 5869 3UTR 100% 13.200 9.240 N ABCA3 n/a
8 TRCN0000059340 GCTCCACACACCTCTGATTAT pLKO.1 4822 CDS 100% 13.200 9.240 N ABCA3 n/a
9 TRCN0000315714 GCTCCACACACCTCTGATTAT pLKO_005 4822 CDS 100% 13.200 9.240 N ABCA3 n/a
10 TRCN0000303487 CACTCAGAAACGAGTACTTTG pLKO_005 2232 CDS 100% 10.800 7.560 N ABCA3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001089.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15350 pDONR223 0% 12.2% 12% None (many diffs) n/a
2 ccsbBroad304_15350 pLX_304 0% 12.2% 12% V5 (many diffs) n/a
3 TRCN0000478249 CCTCCTGACCTGCCACTAAATTGA pLX_317 47.1% 12.2% 12% V5 (many diffs) n/a
Download CSV