Transcript: Mouse NM_001093754.2

Mus musculus DENN/MADD domain containing 2D (Dennd2d), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Dennd2d (72121)
Length:
4050
CDS:
226..1626

Additional Resources:

NCBI RefSeq record:
NM_001093754.2
NBCI Gene record:
Dennd2d (72121)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001093754.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000252000 CCACGATCACTTACCAGTTTC pLKO_005 434 CDS 100% 10.800 15.120 N Dennd2d n/a
2 TRCN0000252002 GCCACTATGCCTCCTATATAA pLKO_005 1379 CDS 100% 15.000 10.500 N Dennd2d n/a
3 TRCN0000252001 AGATAGTAGTACAGGTGTATA pLKO_005 1895 3UTR 100% 13.200 9.240 N Dennd2d n/a
4 TRCN0000251999 CAGCTCTGCTTTACCCATTTA pLKO_005 1040 CDS 100% 13.200 9.240 N Dennd2d n/a
5 TRCN0000251904 GCCAGTGGACAAGGTCATTTC pLKO_005 1408 CDS 100% 10.800 7.560 N Dennd2d n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001093754.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04154 pDONR223 100% 85.4% 89.3% None (many diffs) n/a
2 ccsbBroad304_04154 pLX_304 0% 85.4% 89.3% V5 (many diffs) n/a
3 TRCN0000471945 CTACGATTTATAGTCTTTGTGACC pLX_317 29.2% 85.4% 89.3% V5 (many diffs) n/a
Download CSV