Transcript: Human NM_001097577.3

Homo sapiens angiogenin (ANG), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
ANG (283)
Length:
748
CDS:
130..573

Additional Resources:

NCBI RefSeq record:
NM_001097577.3
NBCI Gene record:
ANG (283)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001097577.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000049666 ACGTTGTTGTTGCTTGTGAAA pLKO.1 506 CDS 100% 4.950 6.930 N ANG n/a
2 TRCN0000049667 GTCCACTTGGATCAGTCAATT pLKO.1 538 CDS 100% 13.200 9.240 N ANG n/a
3 TRCN0000290683 GTCCACTTGGATCAGTCAATT pLKO_005 538 CDS 100% 13.200 9.240 N ANG n/a
4 TRCN0000310245 AGAATAAGCAAGTCTTCTTTC pLKO_005 409 CDS 100% 10.800 7.560 N ANG n/a
5 TRCN0000049663 TGCTGTCCTTGCCTTCCATTT pLKO.1 603 3UTR 100% 10.800 7.560 N ANG n/a
6 TRCN0000290752 TGCTGTCCTTGCCTTCCATTT pLKO_005 603 3UTR 100% 10.800 7.560 N ANG n/a
7 TRCN0000049664 CGGGATGACAGATACTGTGAA pLKO.1 262 CDS 100% 4.950 3.465 N ANG n/a
8 TRCN0000307224 CGGGATGACAGATACTGTGAA pLKO_005 262 CDS 100% 4.950 3.465 N ANG n/a
9 TRCN0000296680 AGGATAACTCCAGGTACACAC pLKO_005 203 CDS 100% 4.050 2.835 N ANG n/a
10 TRCN0000049665 CAACACATTTATTCATGGCAA pLKO.1 327 CDS 100% 2.640 1.848 N ANG n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001097577.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00066 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00066 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000471617 GTAACTCGGTAGCCCTGACTCTAT pLX_317 100% 100% 100% V5 n/a
4 ccsbBroadEn_05814 pDONR223 100% 99.7% 99.3% None 176T>C n/a
5 ccsbBroad304_05814 pLX_304 0% 99.7% 99.3% V5 176T>C n/a
6 TRCN0000469061 CCTGCGAGCCATAGCCCCATCATA pLX_317 83.5% 99.7% 99.3% V5 176T>C n/a
Download CSV