Transcript: Human NM_001097605.2

Homo sapiens X antigen family member 1B (XAGE1B), transcript variant d, mRNA.

Source:
NCBI, updated 2019-02-22
Taxon:
Homo sapiens (human)
Gene:
XAGE1B (653067)
Length:
485
CDS:
136..345

Additional Resources:

NCBI RefSeq record:
NM_001097605.2
NBCI Gene record:
XAGE1B (653067)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001097605.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000115717 CGGCGTCAAGGTGAAGATAAT pLKO.1 319 CDS 100% 13.200 6.600 Y XAGE1B n/a
2 TRCN0000255683 AGAAGAACCAGCAGCTGAAAG pLKO_005 152 CDS 100% 10.800 5.400 Y XAGE1A n/a
3 TRCN0000255685 CAAGAGCTGCATCAGTCAAAC pLKO_005 271 CDS 100% 10.800 5.400 Y XAGE1A n/a
4 TRCN0000265688 CCCTGAGGTCTGGATTCTTTC pLKO_005 48 5UTR 100% 10.800 5.400 Y XAGE1A n/a
5 TRCN0000255684 GACAGAAGAAGATCAGGATAC pLKO_005 197 CDS 100% 6.000 3.000 Y XAGE1A n/a
6 TRCN0000263122 AGACAGAAGAAGATCAGGATA pLKO_005 196 CDS 100% 4.950 2.475 Y XAGE1B n/a
7 TRCN0000263123 AGAGCTGCATCAGTCAAACAC pLKO_005 273 CDS 100% 4.950 2.475 Y XAGE1B n/a
8 TRCN0000256380 AGATCAGGATACAGCTGAGAT pLKO_005 206 CDS 100% 4.950 2.475 Y XAGE1A n/a
9 TRCN0000263121 CGGACACACACAAACACAGAA pLKO_005 87 5UTR 100% 4.950 2.475 Y XAGE1B n/a
10 TRCN0000256382 TGCAAGAGCTGCATCAGTCAA pLKO_005 269 CDS 100% 4.950 2.475 Y XAGE1A n/a
11 TRCN0000263162 CAGTCCCAGGAGCCCAGTAAT pLKO_005 117 5UTR 100% 4.400 2.200 Y XAGE1B n/a
12 TRCN0000371190 ACATGGAAGGTGATCTGCAAG pLKO_005 254 CDS 100% 4.050 2.025 Y XAGE1A n/a
13 TRCN0000256381 AGCTGAAAGTCGGGATCCTAC pLKO_005 164 CDS 100% 4.050 2.025 Y XAGE1A n/a
14 TRCN0000377629 ATCAGGATACAGCTGAGATCC pLKO_005 208 CDS 100% 4.050 2.025 Y XAGE1A n/a
15 TRCN0000281579 CTGAAAGTCGGGATCCTACAC pLKO_005 166 CDS 100% 4.050 2.025 Y XAGE1B n/a
16 TRCN0000263120 CTGGATTCTTTCTCCGCTACT pLKO_005 57 5UTR 100% 4.050 2.025 Y XAGE1B n/a
17 TRCN0000371189 GATTCTTTCTCCGCTACTGAG pLKO_005 60 5UTR 100% 4.050 2.025 Y XAGE1A n/a
18 TRCN0000263124 GCTGAAAGTCGGGATCCTACA pLKO_005 165 CDS 100% 4.050 2.025 Y XAGE1B n/a
19 TRCN0000263163 TGATCTGCAAGAGCTGCATCA pLKO_005 264 CDS 100% 4.050 2.025 Y XAGE1B n/a
20 TRCN0000281463 AGTCCCAGGAGCCCAGTAATG pLKO_005 118 5UTR 100% 3.600 1.800 Y XAGE1A n/a
21 TRCN0000115721 CAGACAGAAGAAGATCAGGAT pLKO.1 195 CDS 100% 2.640 1.320 Y XAGE1B n/a
22 TRCN0000115719 GACATGGAAGGTGATCTGCAA pLKO.1 253 CDS 100% 2.640 1.320 Y XAGE1B n/a
23 TRCN0000371132 TGAAAGTCGGGATCCTACACC pLKO_005 167 CDS 100% 2.640 1.320 Y XAGE1A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001097605.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02178 pDONR223 100% 73.7% 31.1% None 97_112del;207_208ins52 n/a
2 ccsbBroad304_02178 pLX_304 0% 73.7% 31.1% V5 97_112del;207_208ins52 n/a
Download CSV