Transcript: Human NM_001097615.2

Homo sapiens RNA polymerase II subunit J3 (POLR2J3), mRNA.

Source:
NCBI, updated 2019-08-02
Taxon:
Homo sapiens (human)
Gene:
POLR2J3 (548644)
Length:
1680
CDS:
101..448

Additional Resources:

NCBI RefSeq record:
NM_001097615.2
NBCI Gene record:
POLR2J3 (548644)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001097615.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000053029 CACTGGGAAACATCATTAAAT pLKO.1 219 CDS 100% 15.000 7.500 Y POLR2J2 n/a
2 TRCN0000337351 CCTCCTGGCTGTGCTCATATA pLKO_005 1047 3UTR 100% 13.200 6.600 Y UPK3BL1 n/a
3 TRCN0000337349 ATCATCGCCATCCTGTCTATC pLKO_005 1003 3UTR 100% 10.800 5.400 Y UPK3BL1 n/a
4 TRCN0000337418 CCTCACGGGTTCAAGCGATTT pLKO_005 1378 3UTR 100% 10.800 5.400 Y UPK3BL1 n/a
5 TRCN0000337420 GCAGGGAGTGTGAGAAGATAC pLKO_005 1117 3UTR 100% 10.800 5.400 Y UPK3BL1 n/a
6 TRCN0000337352 TGAAGTTCCTGGTGATGAATG pLKO_005 878 3UTR 100% 10.800 5.400 Y UPK3BL1 n/a
7 TRCN0000426974 TGCTATTTGCTGGCTACAAAG pLKO_005 264 CDS 100% 10.800 5.400 Y POLR2J2 n/a
8 TRCN0000053028 CGAGAAGATCACCATTAACAA pLKO.1 145 CDS 100% 5.625 2.813 Y POLR2J2 n/a
9 TRCN0000151823 CGAGAAGATCACCATTAACAA pLKO.1 145 CDS 100% 5.625 2.813 Y POLR2J3 n/a
10 TRCN0000152963 GCGAGAAGATCACCATTAACA pLKO.1 144 CDS 100% 5.625 2.813 Y POLR2J3 n/a
11 TRCN0000419248 AGTTCAGCAGCCACAACATCT pLKO_005 602 3UTR 100% 4.950 2.475 Y POLR2J2 n/a
12 TRCN0000428441 CCCTTGGAGCACAAGATCATC pLKO_005 293 CDS 100% 4.950 2.475 Y POLR2J2 n/a
13 TRCN0000021873 CTGTTTATTCACCATCAACAA pLKO.1 187 CDS 100% 4.950 2.475 Y POLR2J n/a
14 TRCN0000152711 CTTGGAGCACAAGATCATCAT pLKO.1 295 CDS 100% 4.950 2.475 Y POLR2J3 n/a
15 TRCN0000151471 CAATGCCTGTTTATTCACCAT pLKO.1 181 CDS 100% 2.640 1.320 Y POLR2J3 n/a
16 TRCN0000053030 CACCATTAACAAGGACACCAA pLKO.1 154 CDS 100% 2.640 1.320 Y POLR2J2 n/a
17 TRCN0000153197 CCAATGCCTGTTTATTCACCA pLKO.1 180 CDS 100% 2.640 1.320 Y POLR2J3 n/a
18 TRCN0000053032 CCATCAACAAAGAAGACCACA pLKO.1 198 CDS 100% 2.640 1.320 Y POLR2J2 n/a
19 TRCN0000053031 CCGTGATTGTCAGTTTCCTGA pLKO.1 443 CDS 100% 2.640 1.320 Y POLR2J2 n/a
20 TRCN0000174239 CCGTGATTGTCAGTTTCCTGA pLKO.1 443 CDS 100% 2.640 1.320 Y POLR2J2 n/a
21 TRCN0000150598 GAAGATCACCATTAACAAGGA pLKO.1 148 CDS 100% 2.640 1.320 Y POLR2J3 n/a
22 TRCN0000021870 GCAAGTGCTATTTGCTGGCTA pLKO.1 259 CDS 100% 2.640 1.320 Y POLR2J n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001097615.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01243 pDONR223 100% 85.5% 86% None (many diffs) n/a
2 ccsbBroad304_01243 pLX_304 0% 85.5% 86% V5 (many diffs) n/a
3 TRCN0000474650 ACAATCGTGAGTCTTCATTCAACT pLX_317 94.6% 85.5% 86% V5 (many diffs) n/a
Download CSV