Transcript: Human NM_001097634.1

Homo sapiens glucosaminyl (N-acetyl) transferase 1 (GCNT1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-04
Taxon:
Homo sapiens (human)
Gene:
GCNT1 (2650)
Length:
5984
CDS:
940..2226

Additional Resources:

NCBI RefSeq record:
NM_001097634.1
NBCI Gene record:
GCNT1 (2650)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001097634.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000035232 GCGGAGTTTCCAATAGCATAT pLKO.1 1294 CDS 100% 10.800 15.120 N GCNT1 n/a
2 TRCN0000418321 TTAATAGTGGGAGGAGTAAAG pLKO_005 2431 3UTR 100% 10.800 15.120 N GCNT1 n/a
3 TRCN0000097616 CCATCTATATGCCTCAGAATT pLKO.1 1364 CDS 100% 0.000 0.000 N Gcnt1 n/a
4 TRCN0000414122 AGAGGATGCCATCCCATAAAG pLKO_005 1673 CDS 100% 13.200 10.560 N GCNT1 n/a
5 TRCN0000429501 GGGAAGAGGCCGATGCATAAA pLKO_005 2512 3UTR 100% 13.200 10.560 N GCNT1 n/a
6 TRCN0000035233 CCGATTGGAGAGTGTGGTTTA pLKO.1 1479 CDS 100% 10.800 8.640 N GCNT1 n/a
7 TRCN0000035231 CGTTAATGGAAAGCTGACAAA pLKO.1 1722 CDS 100% 4.950 3.960 N GCNT1 n/a
8 TRCN0000421489 TTCATCAAGAGACGCAAATAT pLKO_005 1246 CDS 100% 15.000 10.500 N GCNT1 n/a
9 TRCN0000418681 AGTTAGCTAGAAAGGTGATAG pLKO_005 2390 3UTR 100% 10.800 7.560 N GCNT1 n/a
10 TRCN0000418231 CAGTGTTTGGATGAGCATTTG pLKO_005 2173 CDS 100% 10.800 7.560 N GCNT1 n/a
11 TRCN0000426395 CATACAGCCCTGATGAGTATC pLKO_005 1883 CDS 100% 10.800 7.560 N GCNT1 n/a
12 TRCN0000035230 GCCATCTATATGCCTCAGAAT pLKO.1 1363 CDS 100% 4.950 3.465 N GCNT1 n/a
13 TRCN0000035229 GCCAATAAGTTTGACGTGGAT pLKO.1 2134 CDS 100% 2.640 1.848 N GCNT1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001097634.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00625 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00625 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000477096 CAAATGAGACTATAAGTTACACGT pLX_317 33.1% 100% 100% V5 n/a
Download CSV