Transcript: Human NM_001098426.2

Homo sapiens SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 2 (SMARCD2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
SMARCD2 (6603)
Length:
2464
CDS:
12..1607

Additional Resources:

NCBI RefSeq record:
NM_001098426.2
NBCI Gene record:
SMARCD2 (6603)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001098426.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000021268 TCAGGCGTACATGGATCTCTT pLKO.1 479 CDS 100% 4.950 6.930 N SMARCD2 n/a
2 TRCN0000349661 TCAGGCGTACATGGATCTCTT pLKO_005 479 CDS 100% 4.950 6.930 N SMARCD2 n/a
3 TRCN0000021267 GCGGGAGTACATCAACTGCAA pLKO.1 1058 CDS 100% 2.640 3.696 N SMARCD2 n/a
4 TRCN0000319011 GCGGGAGTACATCAACTGCAA pLKO_005 1058 CDS 100% 2.640 3.696 N SMARCD2 n/a
5 TRCN0000426465 GCCGAGACCTCAAGATCATCA pLKO_005 1438 CDS 100% 4.950 3.960 N Smarcd2 n/a
6 TRCN0000021264 GCTTCGGATCTACATTTCCAA pLKO.1 590 CDS 100% 3.000 2.100 N SMARCD2 n/a
7 TRCN0000319010 GCTTCGGATCTACATTTCCAA pLKO_005 590 CDS 100% 3.000 2.100 N SMARCD2 n/a
8 TRCN0000021266 CCATGATGGATCCATTCCGAA pLKO.1 340 CDS 100% 2.640 1.848 N SMARCD2 n/a
9 TRCN0000319081 CCATGATGGATCCATTCCGAA pLKO_005 340 CDS 100% 2.640 1.848 N SMARCD2 n/a
10 TRCN0000021265 CAAGATCATCACTGATGTGAT pLKO.1 1448 CDS 100% 0.495 0.347 N SMARCD2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001098426.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14842 pDONR223 86.8% 88.9% 13.5% None (many diffs) n/a
2 ccsbBroad304_14842 pLX_304 0% 88.9% 13.5% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000477621 TGTAATACAGTTGTACGTCTATAC pLX_317 34.1% 88.9% 13.5% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV