Transcript: Human NM_001098493.2

Homo sapiens zinc finger protein 419 (ZNF419), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
ZNF419 (79744)
Length:
3703
CDS:
202..1695

Additional Resources:

NCBI RefSeq record:
NM_001098493.2
NBCI Gene record:
ZNF419 (79744)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001098493.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000419155 CAGTTTACAATGTGGACAATG pLKO_005 1821 3UTR 100% 10.800 7.560 N ZNF419 n/a
2 TRCN0000428070 GCCTTAGGGTGACAGGTTATG pLKO_005 1915 3UTR 100% 10.800 7.560 N ZNF419 n/a
3 TRCN0000416557 GAGTTGCAAAGTTCACCTATC pLKO_005 606 CDS 100% 6.000 4.200 N ZNF419 n/a
4 TRCN0000017479 CGGGTGTAGTAACTGTGGAAA pLKO.1 939 CDS 100% 4.950 3.465 N ZNF419 n/a
5 TRCN0000017478 CTTCTGTAGGACTGCTCAGTT pLKO.1 506 CDS 100% 4.950 3.465 N ZNF419 n/a
6 TRCN0000017481 TGTGGGAAGTTATTTAGAGAT pLKO.1 868 CDS 100% 4.950 3.465 N ZNF419 n/a
7 TRCN0000017480 CCACCCTAGTTAGACATCAGA pLKO.1 1397 CDS 100% 3.000 2.100 N ZNF419 n/a
8 TRCN0000107857 GCAGTGAATGTGGGAAGTTAT pLKO.1 860 CDS 100% 13.200 6.600 Y ZNF773 n/a
9 TRCN0000074123 CGCCTGTAATCCCAACACTTT pLKO.1 3069 3UTR 100% 4.950 2.475 Y GJD4 n/a
10 TRCN0000166650 CGCCTGTAATCCCAACACTTT pLKO.1 3069 3UTR 100% 4.950 2.475 Y C9orf85 n/a
11 TRCN0000107859 GCATCTTCCAAGACCCATGAA pLKO.1 367 CDS 100% 4.950 2.475 Y ZNF773 n/a
12 TRCN0000017482 CGAAGGATTCACACTGGAGAA pLKO.1 1666 CDS 100% 4.050 2.025 Y ZNF419 n/a
13 TRCN0000138140 GATTGAGACCATCCTGGCTAA pLKO.1 3124 3UTR 100% 4.050 2.025 Y LOC441087 n/a
14 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 2860 3UTR 100% 5.625 2.813 Y KLHL30 n/a
15 TRCN0000107855 CACCAGAAAGTTCACAGTGTA pLKO.1 1736 3UTR 100% 4.950 2.475 Y ZNF773 n/a
16 TRCN0000012945 GCAGTGAATGTGGGAAAGCTT pLKO.1 776 CDS 100% 3.000 1.500 Y ZNF146 n/a
17 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 2860 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001098493.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08953 pDONR223 100% 97.2% 97% None (many diffs) n/a
2 ccsbBroad304_08953 pLX_304 0% 97.2% 97% V5 (many diffs) n/a
3 TRCN0000467158 GTGTAGGAGTTCGCCGCGGACCGG pLX_317 24.8% 97.2% 97% V5 (many diffs) n/a
Download CSV