Transcript: Human NM_001098633.4

Homo sapiens AKT1 substrate 1 (AKT1S1), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
AKT1S1 (84335)
Length:
1775
CDS:
127..897

Additional Resources:

NCBI RefSeq record:
NM_001098633.4
NBCI Gene record:
AKT1S1 (84335)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001098633.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000160993 GCGACAGATTCCTTCTATTAA pLKO.1 1132 3UTR 100% 15.000 21.000 N AKT1S1 n/a
2 TRCN0000166394 CCAGAAGCTGAAGCGGAAATA pLKO.1 873 CDS 100% 13.200 9.240 N AKT1S1 n/a
3 TRCN0000165347 GCAGCTGGGCATTAGTGATAA pLKO.1 480 CDS 100% 13.200 9.240 N AKT1S1 n/a
4 TRCN0000158835 GCCTTCAATTTACGTTCTTTA pLKO.1 1411 3UTR 100% 13.200 9.240 N AKT1S1 n/a
5 TRCN0000439506 ATCTGTCCCGTTTCCCGATTG pLKO_005 1088 3UTR 100% 6.000 4.200 N AKT1S1 n/a
6 TRCN0000165801 CGGTCATCAGATGAGGAGAAT pLKO.1 727 CDS 100% 4.950 3.465 N AKT1S1 n/a
7 TRCN0000439318 AGCGACTTCCAGAAGCTGAAG pLKO_005 865 CDS 100% 4.050 2.835 N AKT1S1 n/a
8 TRCN0000165800 CTTCAAGGAGAAGAGGACAGA pLKO.1 702 CDS 100% 2.640 1.848 N AKT1S1 n/a
9 TRCN0000165043 GCTCTTTGTGATGGATGAGGA pLKO.1 507 CDS 100% 2.640 1.848 N AKT1S1 n/a
10 TRCN0000166786 CTCTTTGTGATGGATGAGGAC pLKO.1 508 CDS 100% 2.160 1.512 N AKT1S1 n/a
11 TRCN0000197732 GAAGCTGAAGCGGAAATATTA pLKO.1 876 CDS 100% 15.000 10.500 N Akt1s1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001098633.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12815 pDONR223 100% 49.2% 49.2% None 1_390del n/a
2 ccsbBroad304_12815 pLX_304 0% 49.2% 49.2% V5 1_390del n/a
3 TRCN0000479778 TTATACGTGCAAGCCCCTCCCCAA pLX_317 88.6% 49.2% 49.2% V5 1_390del n/a
Download CSV