Transcript: Human NM_001098637.2

Homo sapiens PWWP domain containing 2B (PWWP2B), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
PWWP2B (170394)
Length:
2312
CDS:
28..1527

Additional Resources:

NCBI RefSeq record:
NM_001098637.2
NBCI Gene record:
PWWP2B (170394)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001098637.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000156497 CGGACTTGTCTTCTGGAAGTT pLKO.1 1160 CDS 100% 4.950 3.465 N PWWP2B n/a
2 TRCN0000156873 GTGAGGACGATGACTTCAAGA pLKO.1 1184 CDS 100% 4.950 3.465 N PWWP2B n/a
3 TRCN0000156968 GACGATGACTTCAAGAGCTGT pLKO.1 1189 CDS 100% 2.640 1.848 N PWWP2B n/a
4 TRCN0000157964 CGCTGAGTGTATTTCTTCCCA pLKO.1 1697 3UTR 100% 0.750 0.525 N PWWP2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001098637.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13359 pDONR223 100% 70.8% 70.6% None (many diffs) n/a
2 ccsbBroad304_13359 pLX_304 0% 70.8% 70.6% V5 (many diffs) n/a
3 TRCN0000474717 TGTGACCTCCGTAGTTACCAAATG pLX_317 28.6% 70.8% 70.6% V5 (many diffs) n/a
Download CSV