Transcript: Mouse NM_001099675.1

Mus musculus translocase of outer mitochondrial membrane 5 homolog (yeast) (Tomm5), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Tomm5 (68512)
Length:
651
CDS:
81..236

Additional Resources:

NCBI RefSeq record:
NM_001099675.1
NBCI Gene record:
Tomm5 (68512)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001099675.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000253564 GCTGATTAAACGGACATATAA pLKO_005 326 3UTR 100% 15.000 10.500 N Tomm5 n/a
2 TRCN0000253562 GCTGCGAGTCACTCCATATAT pLKO_005 191 CDS 100% 15.000 10.500 N Tomm5 n/a
3 TRCN0000265399 GGTCTCCTCCATTCGGAACTT pLKO_005 152 CDS 100% 4.950 3.465 N Tomm5 n/a
4 TRCN0000253563 TTAAAGAAGCTGGATAGCATC pLKO_005 213 CDS 100% 4.050 2.835 N Tomm5 n/a
5 TRCN0000265396 GGAGGAGATGAAGCGGAAGAT pLKO_005 119 CDS 100% 4.950 2.970 N Tomm5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001099675.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05647 pDONR223 100% 90.1% 96% None (many diffs) n/a
2 ccsbBroad304_05647 pLX_304 0% 90.1% 96% V5 (many diffs) n/a
3 TRCN0000479412 TATCCTGTCCGACTTTCCCACACA pLX_317 100% 90.1% 96% V5 (many diffs) n/a
Download CSV