Transcript: Human NM_001100600.2

Homo sapiens monocyte to macrophage differentiation associated 2 (MMD2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
MMD2 (221938)
Length:
2381
CDS:
171..983

Additional Resources:

NCBI RefSeq record:
NM_001100600.2
NBCI Gene record:
MMD2 (221938)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001100600.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000063193 CGACCGGATGGTCATCTATTT pLKO.1 488 CDS 100% 13.200 18.480 N MMD2 n/a
2 TRCN0000063196 GCTTCTCTGCTACGTCGTAAT pLKO.1 725 CDS 100% 10.800 15.120 N MMD2 n/a
3 TRCN0000063195 GAAGACGAAATACGCGAGGTT pLKO.1 200 CDS 100% 2.640 3.696 N MMD2 n/a
4 TRCN0000434832 TTAGATGAGTGTTTCCTAATA pLKO_005 1213 3UTR 100% 13.200 9.240 N MMD2 n/a
5 TRCN0000429923 TGGCATCTCTTTGTAGCATTT pLKO_005 885 CDS 100% 10.800 7.560 N MMD2 n/a
6 TRCN0000063197 CAGCCCACAGAGTATGAACAT pLKO.1 255 CDS 100% 4.950 3.465 N MMD2 n/a
7 TRCN0000437450 CCCATGCTTTCTGGATCATCC pLKO_005 292 CDS 100% 4.050 2.835 N MMD2 n/a
8 TRCN0000437139 TCTACTTCCTGTCGGACGATG pLKO_005 337 CDS 100% 4.050 2.835 N MMD2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001100600.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14443 pDONR223 100% 90.6% 89.6% None (many diffs) n/a
2 ccsbBroad304_14443 pLX_304 0% 90.6% 89.6% V5 (not translated due to frame shift) (many diffs) n/a
3 TRCN0000479807 CACGACGGATGCCAAAATTATGAA pLX_317 46.7% 90.6% 89.6% V5 (not translated due to frame shift) (many diffs) n/a
Download CSV