Construct: ORF TRCN0000479807
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF001835.2_s317c1
- Derived from:
- ccsbBroadEn_14443
- DNA Barcode:
- CACGACGGATGCCAAAATTATGAA
- Epitope Tag:
- V5 (not translated due to frame shift)
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- MMD2 (221938)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000479807
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 221938 | MMD2 | monocyte to macrophage diff... | NM_198403.4 | 99.4% | 98.3% | (many diffs) |
| 2 | human | 221938 | MMD2 | monocyte to macrophage diff... | NM_001100600.2 | 90.6% | 89.6% | (many diffs) |
| 3 | human | 221938 | MMD2 | monocyte to macrophage diff... | NM_001270375.2 | 76.8% | 72.5% | (many diffs) |
| 4 | human | 221938 | MMD2 | monocyte to macrophage diff... | NR_072989.2 | 54.4% | (many diffs) | |
| 5 | mouse | 75104 | Mmd2 | monocyte to macrophage diff... | NM_175217.6 | 88.1% | 93.9% | (many diffs) |
| 6 | mouse | 75104 | Mmd2 | monocyte to macrophage diff... | XM_011240988.2 | 82.6% | 88.2% | (many diffs) |
| 7 | mouse | 75104 | Mmd2 | monocyte to macrophage diff... | XM_006504753.3 | 53.7% | 56.9% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 804
- ORF length:
- 738
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgtt cgccccccgg ctgctggatt tccagaagac gaaatacgcg aggttcatga 121 accaccgagt ccctgcccac aagaggtacc agcccacaga gtatgaacat gcggccaact 181 gtgccaccca tgctttctgg atcatcccca gcatcctggg cagctccaac ctctacttcc 241 tgtcggacga tgactgggag accatctctg cctggatcta cggcctcggc ctctgcggcc 301 tcttcgtggt gtccactgtg tttcacacca tctcctggaa gaagagccac ctaaggatgg 361 tggaacactg tatacacatg ttcgaccgga tggtcatcta tttcttcata gcggcttcct 421 acgcaccctg gctgaacctt cgggagctgg gcccctgggC CTCCCACATG CGCTGGCTGG 481 TCTGGATTAT GGCTTCCGTG GGCACCATCT ATGTCTTCTT CTTCCATGAG CGGTACAAGC 541 TTGTGGAGCT TCTCTGCTAC GTCGTAATGG GCTTCTTCCC CGCCCTGGTC ATCCTCTCCA 601 TGCCCAACAC CGAGGGCATC TGGGAGCTGG TGACCGGAGG GGTCTTCTAC TGCCTGGGCA 661 TGGTCTTCTT CAAGAGTGAC GGGAGGATCC CCTTTGCCCA CGCAATCTGG CATCTCTTTG 721 TAGCATTTGG TGCTGGTACC CACTACTATG CCATCTGGAG GTACCTCTAT CTGCCCAGCA 781 CCCTGCAGAC CAAGTGTCCA AATGCCCAAC TTTCTTGTAC AAAGTGGTTG ATATCGGTAA 841 GCCTATCCCT AACCCTCTCC TCGGTCTCGA TTCTACGTAG TAATGAACTA GTCCGTAACT 901 TGAAAGTATT TCGATTTCTT GGCTTTATAT ATCTTGTGGA AAGGACGACA CGACGGATGC 961 CAAAATTATG AAACGCGTTA AGTCgacaat caacctctgg attacaaaat ttgtgaaaga 1021 tt