Transcript: Human NM_001100624.2

Homo sapiens centromere protein N (CENPN), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-04
Taxon:
Homo sapiens (human)
Gene:
CENPN (55839)
Length:
4663
CDS:
791..1810

Additional Resources:

NCBI RefSeq record:
NM_001100624.2
NBCI Gene record:
CENPN (55839)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001100624.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000000325 GATGAGTAAAGGACCAGGTGA pLKO.1 1051 CDS 100% 2.640 2.112 N CENPN n/a
2 TRCN0000297272 GATGAGTAAAGGACCAGGTGA pLKO_005 1051 CDS 100% 2.640 2.112 N CENPN n/a
3 TRCN0000279945 GCCCTGTTAGACATCATTTAT pLKO_005 989 CDS 100% 15.000 10.500 N CENPN n/a
4 TRCN0000000322 ATGAGTAAAGGACCAGGTGAA pLKO.1 1052 CDS 100% 4.050 2.835 N CENPN n/a
5 TRCN0000000321 TGAACTGACAACAATCCTGAA pLKO.1 847 CDS 100% 4.050 2.835 N CENPN n/a
6 TRCN0000279878 TGAACTGACAACAATCCTGAA pLKO_005 847 CDS 100% 4.050 2.835 N CENPN n/a
7 TRCN0000000323 ACAGTACACAAAGCCAAACCA pLKO.1 1207 CDS 100% 3.000 2.100 N CENPN n/a
8 TRCN0000279880 ACAGTACACAAAGCCAAACCA pLKO_005 1207 CDS 100% 3.000 2.100 N CENPN n/a
9 TRCN0000000324 AGAGAAACTGAGGAGAATGCA pLKO.1 1160 CDS 100% 3.000 2.100 N CENPN n/a
10 TRCN0000279942 AGAGAAACTGAGGAGAATGCA pLKO_005 1160 CDS 100% 3.000 2.100 N CENPN n/a
11 TRCN0000084008 CGCCTATAATCCCAGCACTTT pLKO.1 3942 3UTR 100% 4.950 2.475 Y NPHS1 n/a
12 TRCN0000138391 CGCCTGTAATCCTAGCACTTT pLKO.1 3645 3UTR 100% 4.950 2.475 Y DENND6A n/a
13 TRCN0000165704 CAATGGCACAATCTTGGCTCA pLKO.1 2789 3UTR 100% 2.160 1.080 Y LOC652276 n/a
14 TRCN0000138772 GCAGGAGAATCGCTTGAACTT pLKO.1 4112 3UTR 100% 4.950 2.475 Y DCAF11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001100624.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15915 pDONR223 0% 57.8% 51.8% None (many diffs) n/a
2 ccsbBroad304_15915 pLX_304 0% 57.8% 51.8% V5 (many diffs) n/a
3 TRCN0000468938 AGGTTCCTGCTAGTATCATAGCCG pLX_317 72.9% 57.8% 51.8% V5 (many diffs) n/a
Download CSV