Transcript: Mouse NM_001101452.1

Mus musculus sulfotransferase family 3A, member 2 (Sult3a2), mRNA.

Source:
NCBI, updated 2016-04-20
Taxon:
Mus musculus (mouse)
Gene:
Sult3a2 (215895)
Length:
882
CDS:
1..882

Additional Resources:

NCBI RefSeq record:
NM_001101452.1
NBCI Gene record:
Sult3a2 (215895)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001101452.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000270200 CGTTAGTTAGTATGGATATAG pLKO_005 56 CDS 100% 13.200 18.480 N Sult3a2 n/a
2 TRCN0000203209 GCGTTAGTTAGTATGGATATA pLKO.1 55 CDS 100% 13.200 18.480 N Sult3a2 n/a
3 TRCN0000270248 ACAGATCCTCTGCTTAATTTG pLKO_005 159 CDS 100% 13.200 10.560 N Sult3a2 n/a
4 TRCN0000270247 TACCATCCTTTGAGTACAATA pLKO_005 230 CDS 100% 0.000 0.000 N Sult3a2 n/a
5 TRCN0000270245 TGTACTCAAAGCTTCAGATAC pLKO_005 420 CDS 100% 10.800 7.560 N Sult3a2 n/a
6 TRCN0000187028 CGAGCAAACAATGAACACATT pLKO.1 688 CDS 100% 4.950 3.465 N Sult3a2 n/a
7 TRCN0000188676 GTCACCGGAATGGAACTGAAA pLKO.1 188 CDS 100% 4.950 3.465 N Sult3a2 n/a
8 TRCN0000270246 TTCGGGATGATGACATCTTTA pLKO_005 101 CDS 100% 13.200 7.920 N Sult3a2 n/a
9 TRCN0000204153 GAAACTTGGTAGGAAGCCTTT pLKO.1 473 CDS 100% 4.050 2.430 N Sult3a2 n/a
10 TRCN0000188307 CCTCAGAAGCTCAGTGCTTAA pLKO.1 576 CDS 100% 10.800 5.400 Y Sult3a2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001101452.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.