Transcript: Human NM_001101676.2

Homo sapiens sterile alpha motif domain containing 12 (SAMD12), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
SAMD12 (401474)
Length:
8875
CDS:
148..633

Additional Resources:

NCBI RefSeq record:
NM_001101676.2
NBCI Gene record:
SAMD12 (401474)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001101676.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000442799 GTGGAATCTCAATCCATTAAA pLKO_005 244 CDS 100% 15.000 10.500 N SAMD12 n/a
2 TRCN0000146833 CGAGAAGAAGTCAGAAATCTA pLKO.1 574 CDS 100% 5.625 3.938 N SAMD12 n/a
3 TRCN0000131130 GCAGCACATCTTACAACAGGT pLKO.1 537 CDS 100% 2.640 1.848 N SAMD12 n/a
4 TRCN0000149215 GTGCGAGAAGAAGTCAGAAAT pLKO.1 571 CDS 100% 13.200 7.920 N SAMD12 n/a
5 TRCN0000166364 CACACACACACACACACACAA pLKO.1 7812 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001101676.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05645 pDONR223 100% 77.5% 75.6% None (many diffs) n/a
2 ccsbBroad304_05645 pLX_304 0% 77.5% 75.6% V5 (many diffs) n/a
3 TRCN0000475460 CGTATAAGACGAATGCCGAGTAGC pLX_317 13.7% 77.5% 75.6% V5 (many diffs) n/a
Download CSV