Transcript: Human NM_001105539.3

Homo sapiens zinc finger and BTB domain containing 10 (ZBTB10), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-06
Taxon:
Homo sapiens (human)
Gene:
ZBTB10 (65986)
Length:
9938
CDS:
586..3201

Additional Resources:

NCBI RefSeq record:
NM_001105539.3
NBCI Gene record:
ZBTB10 (65986)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001105539.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000237887 ATATTAGCCTCAGCCTATATA pLKO_005 5659 3UTR 100% 15.000 21.000 N ZBTB10 n/a
2 TRCN0000237888 CCGTTTCTTTAAGACTTTATA pLKO_005 1743 CDS 100% 15.000 21.000 N ZBTB10 n/a
3 TRCN0000164357 CGACGTTATGGTGTTTGTGTA pLKO.1 2983 CDS 100% 4.950 6.930 N ZBTB10 n/a
4 TRCN0000237891 TGTTCAAACTTGCCGAAATTT pLKO_005 1938 CDS 100% 15.000 12.000 N ZBTB10 n/a
5 TRCN0000162604 CAACACGGAATCTTACCAATT pLKO.1 2093 CDS 100% 10.800 8.640 N ZBTB10 n/a
6 TRCN0000163313 GCAACACGGAATCTTACCAAT pLKO.1 2092 CDS 100% 4.950 3.960 N ZBTB10 n/a
7 TRCN0000165038 GCCCAAGTCTCTAATGCAGAA pLKO.1 1299 CDS 100% 4.050 3.240 N ZBTB10 n/a
8 TRCN0000237890 TCTGTAGTTGTGGACTATAAT pLKO_005 2005 CDS 100% 15.000 10.500 N ZBTB10 n/a
9 TRCN0000159344 GCCGTTTCTTTAAGACTTTAT pLKO.1 1742 CDS 100% 13.200 9.240 N ZBTB10 n/a
10 TRCN0000159851 GATAGGAATGTGAATGCAAAT pLKO.1 2482 CDS 100% 10.800 7.560 N ZBTB10 n/a
11 TRCN0000000349 AGTAGTTATGTTGCTGTGAAA pLKO.1 3305 3UTR 100% 4.950 3.465 N ZBTB10 n/a
12 TRCN0000160852 GCTTACATTCATGTGCTACTT pLKO.1 3513 3UTR 100% 4.950 3.465 N ZBTB10 n/a
13 TRCN0000237889 ATGATTAACTGACCTACTATA pLKO_005 3194 CDS 100% 13.200 7.920 N ZBTB10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001105539.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12520 pDONR223 100% 80.1% 80.1% None 1_519del n/a
2 ccsbBroad304_12520 pLX_304 0% 80.1% 80.1% V5 1_519del n/a
3 TRCN0000475368 CCCGTTGTTTGGAGAGTTATGAAG pLX_317 10.6% 80.1% 80.1% V5 1_519del n/a
Download CSV