Transcript: Human NM_001105544.1

Homo sapiens ethylmalonyl-CoA decarboxylase 1 (ECHDC1), transcript variant 3, mRNA.

Source:
NCBI, updated 2018-12-09
Taxon:
Homo sapiens (human)
Gene:
ECHDC1 (55862)
Length:
2132
CDS:
280..960

Additional Resources:

NCBI RefSeq record:
NM_001105544.1
NBCI Gene record:
ECHDC1 (55862)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001105544.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000052478 GCCTGCAAATTTAGAGGCTAT pLKO.1 912 CDS 100% 4.050 5.670 N ECHDC1 n/a
2 TRCN0000052482 GCATTACAGAACGAAAGAGAT pLKO.1 868 CDS 100% 4.950 3.960 N ECHDC1 n/a
3 TRCN0000412678 ATTTACTACAGCATGTGATTT pLKO_005 528 CDS 100% 13.200 9.240 N ECHDC1 n/a
4 TRCN0000052479 CCACAAAGAGATGGGCATAAT pLKO.1 585 CDS 100% 13.200 9.240 N ECHDC1 n/a
5 TRCN0000191025 CCTGCAAATTTAGAGGCTATT pLKO.1 913 CDS 100% 10.800 7.560 N Echdc1 n/a
6 TRCN0000436509 TAATAAGTGTTGCGCTGGTTC pLKO_005 479 CDS 100% 4.050 2.430 N ECHDC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001105544.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03671 pDONR223 100% 75% 75% None 0_1ins225 n/a
2 ccsbBroad304_03671 pLX_304 0% 75% 75% V5 0_1ins225 n/a
3 TRCN0000467959 GAAAAGTACATTAACGTACGGTCC pLX_317 49.4% 75% 75% V5 0_1ins225 n/a
Download CSV