Construct: ORF TRCN0000467959
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF007417.1_s317c1
- Derived from:
- ccsbBroadEn_03671
- DNA Barcode:
- GAAAAGTACATTAACGTACGGTCC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- ECHDC1 (55862)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000467959
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 55862 | ECHDC1 | ethylmalonyl-CoA decarboxyl... | NM_001002030.2 | 100% | 100% | |
| 2 | human | 55862 | ECHDC1 | ethylmalonyl-CoA decarboxyl... | XM_005267047.3 | 100% | 100% | |
| 3 | human | 55862 | ECHDC1 | ethylmalonyl-CoA decarboxyl... | XM_005267048.2 | 100% | 100% | |
| 4 | human | 55862 | ECHDC1 | ethylmalonyl-CoA decarboxyl... | NM_001139510.1 | 98% | 98% | 1_18del |
| 5 | human | 55862 | ECHDC1 | ethylmalonyl-CoA decarboxyl... | NM_001105544.1 | 75% | 75% | 0_1ins225 |
| 6 | human | 55862 | ECHDC1 | ethylmalonyl-CoA decarboxyl... | XM_017011056.2 | 75% | 75% | 0_1ins225 |
| 7 | human | 55862 | ECHDC1 | ethylmalonyl-CoA decarboxyl... | XM_011535942.3 | 55.7% | 52.2% | 0_1ins377;38_78del |
| 8 | human | 55862 | ECHDC1 | ethylmalonyl-CoA decarboxyl... | NM_018479.3 | 48.1% | 38.6% | 360_361ins53;435_436ins415 |
| 9 | human | 55862 | ECHDC1 | ethylmalonyl-CoA decarboxyl... | XM_005267050.3 | 48.1% | 38.6% | 360_361ins53;435_436ins415 |
| 10 | human | 55862 | ECHDC1 | ethylmalonyl-CoA decarboxyl... | XM_024446490.1 | 48.1% | 38.6% | 360_361ins53;435_436ins415 |
| 11 | human | 55862 | ECHDC1 | ethylmalonyl-CoA decarboxyl... | XM_005267049.2 | 47.2% | 37.9% | 1_18del;378_379ins53;453_454ins415 |
| 12 | human | 55862 | ECHDC1 | ethylmalonyl-CoA decarboxyl... | XM_011535943.2 | 45.1% | 45.2% | 1_18del;435_435delGins487 |
| 13 | human | 55862 | ECHDC1 | ethylmalonyl-CoA decarboxyl... | NM_001105545.1 | 23.2% | 15% | 0_1ins225;135_136ins53;210_211ins415 |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 969
- ORF length:
- 903
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc gaaaagtctt ttgaagacag cctctctgtc tggaaggaca aaattgctac 121 atcaaacagg attgtcactt tatagtacat cccatggatt ttatgaggaa gaagtgaaaa 181 aaacacttca gcagtttcct ggtggatcca ttgaccttca gaaggaagac aatggcattg 241 gcattcttac tctgaacaat ccaagtagaa tgaatgcctt ttcaggtgtt atgatgctac 301 aacttctgga aaaagtaatt gaattggaaa attggacaga ggggaaaggc ctcattgtcc 361 gtggggcaaa aaatactttc tcttcaggat ctgatctgaa tgctgtgaaa tcactaggaa 421 ctccagagga tggaatggcc gtatgcatgt tcatgcaaaa caccttaaca agatttatga 481 gacttccttt aataagtgtt gcgctggttc aaggttgggc attGGGTGGA GGAGCAGAAT 541 TTACTACAGC ATGTGATTTC AGGTTAATGA CTCCAGAGAG TAAGATCAGA TTCGTCCACA 601 AAGAGATGGG CATAATACCA AGCTGGGGTG GCACCACCCG GCTAGTTGAA ATAATCGGAA 661 GTAGACAAGC TCTCAAAGTG TTGAGTGGGG CCCTTAAACT GGATTCAAAA AATGCTCTAA 721 ACATAGGAAT GGTTGAAGAG GTCTTGCAGT CTTCAGATGA AACTAAATCT CTAGAAGAGG 781 CACAAGAATG GCTAAAGCAA TTCATCCAAG GGCCACCGGA AGTAATTAGA GCTTTGAAAA 841 AATCTGTTTG TTCAGGCAGA GAGCTATATT TGGAGGAAGC ATTACAGAAC GAAAGAGATC 901 TTTTAGGAAC AGTTTGGGGT GGGCCTGCAA ATTTAGAGGC TATTGCTAAG AAAGGAAAAT 961 TTAATAAATA CCCAACTTTC TTGTACAAAG TGGTTGATAT CGGTAAGCCT ATCCCTAACC 1021 CTCTCCTCGG TCTCGATTCT ACGTAGTAAT GAACTAGTCC GTAACTTGAA AGTATTTCGA 1081 TTTCTTGGCT TTATATATCT TGTGGAAAGG ACGAGAAAAG TACATTAACG TACGGTCCAC 1141 GCGTTAAGTC gacaatcaac ctctggatta caaaatttgt gaaagatt