Transcript: Mouse NM_001109757.2

Mus musculus ATPase, Cu++ transporting, alpha polypeptide (Atp7a), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Atp7a (11977)
Length:
8198
CDS:
175..4653

Additional Resources:

NCBI RefSeq record:
NM_001109757.2
NBCI Gene record:
Atp7a (11977)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001109757.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000101813 CCCGAGTGATAGCAGAGTTTA pLKO.1 1766 CDS 100% 13.200 18.480 N Atp7a n/a
2 TRCN0000316362 CCCGAGTGATAGCAGAGTTTA pLKO_005 1766 CDS 100% 13.200 18.480 N Atp7a n/a
3 TRCN0000101811 GCCGTGTTATTGAAGGACATT pLKO.1 2729 CDS 100% 4.950 3.960 N Atp7a n/a
4 TRCN0000316440 GCCGTGTTATTGAAGGACATT pLKO_005 2729 CDS 100% 4.950 3.960 N Atp7a n/a
5 TRCN0000101814 CCCTCAAGTAATGAGCTAGAA pLKO.1 1570 CDS 100% 4.950 3.465 N Atp7a n/a
6 TRCN0000316363 CCCTCAAGTAATGAGCTAGAA pLKO_005 1570 CDS 100% 4.950 3.465 N Atp7a n/a
7 TRCN0000101812 CGGACCATTGAACAGCAGATT pLKO.1 244 CDS 100% 4.950 3.465 N Atp7a n/a
8 TRCN0000316361 CGGACCATTGAACAGCAGATT pLKO_005 244 CDS 100% 4.950 3.465 N Atp7a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001109757.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.