Transcript: Mouse NM_001110142.1

Mus musculus cullin 4B (Cul4b), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-11
Taxon:
Mus musculus (mouse)
Gene:
Cul4b (72584)
Length:
5079
CDS:
132..3044

Additional Resources:

NCBI RefSeq record:
NM_001110142.1
NBCI Gene record:
Cul4b (72584)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001110142.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000273707 TGCTGCGATCGTTCGAATTAT pLKO_005 2855 CDS 100% 15.000 21.000 N Cul4b n/a
2 TRCN0000281899 GGTGATTCTTATACATCATTA pLKO_005 3359 3UTR 100% 13.200 18.480 N Cul4b n/a
3 TRCN0000012791 CCACGTACCTATACAGAAGAA pLKO.1 626 CDS 100% 4.950 6.930 N Cul4b n/a
4 TRCN0000281898 CCACGTACCTATACAGAAGAA pLKO_005 626 CDS 100% 4.950 6.930 N Cul4b n/a
5 TRCN0000012792 CCATATAATTGATACCTGCTT pLKO.1 1883 CDS 100% 2.640 3.696 N Cul4b n/a
6 TRCN0000012788 TGGGAATAGTTGTGTGGACTT pLKO.1 3158 3UTR 100% 4.050 3.240 N Cul4b n/a
7 TRCN0000273755 ATGGGTTACTGGCCAACATAT pLKO_005 2352 CDS 100% 13.200 9.240 N Cul4b n/a
8 TRCN0000006534 CGGGACTACATGGAAAGAGAT pLKO.1 2988 CDS 100% 4.950 3.465 N CUL4B n/a
9 TRCN0000012789 GCTGAATTTAAAGAGGGCAAA pLKO.1 2502 CDS 100% 4.050 2.835 N Cul4b n/a
10 TRCN0000012790 GCTGTCTGATTTGCAAATTTA pLKO.1 1424 CDS 100% 15.000 9.000 N Cul4b n/a
11 TRCN0000273756 GCTGTCTGATTTGCAAATTTA pLKO_005 1424 CDS 100% 15.000 9.000 N Cul4b n/a
12 TRCN0000204419 CCTCCTCATCTTCCTCATCTA pLKO.1 709 CDS 100% 4.950 2.475 Y OR2V2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001110142.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07242 pDONR223 100% 85.1% 89.7% None (many diffs) n/a
2 TRCN0000478902 TTCATTGCTAGTTGATATCTTTTC pLX_317 12.9% 85.1% 89.7% V5 (many diffs) n/a
Download CSV