Transcript: Mouse NM_001110152.2

Mus musculus prefoldin 4 (Pfdn4), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-10
Taxon:
Mus musculus (mouse)
Gene:
Pfdn4 (109054)
Length:
887
CDS:
217..621

Additional Resources:

NCBI RefSeq record:
NM_001110152.2
NBCI Gene record:
Pfdn4 (109054)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001110152.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000252946 GTGCAGCTATACGCGAAATTT pLKO_005 565 CDS 100% 15.000 21.000 N Pfdn4 n/a
2 TRCN0000176766 CGAAATTTGGCAGCAACATAA pLKO.1 578 CDS 100% 13.200 18.480 N Pfdn4 n/a
3 TRCN0000252943 CCTACCAGATCGGAGACGTTT pLKO_005 419 CDS 100% 4.950 6.930 N Pfdn4 n/a
4 TRCN0000252944 GCAGATGAAAGCTAAACATTT pLKO_005 607 CDS 100% 13.200 9.240 N Pfdn4 n/a
5 TRCN0000216381 GATAATTTCCCTTCTCCAAAT pLKO.1 680 3UTR 100% 10.800 7.560 N Pfdn4 n/a
6 TRCN0000252945 GATAATTTCCCTTCTCCAAAT pLKO_005 680 3UTR 100% 10.800 7.560 N Pfdn4 n/a
7 TRCN0000176856 GAAGAAACACAGGAAATGTTA pLKO.1 457 CDS 100% 5.625 3.938 N Pfdn4 n/a
8 TRCN0000215502 GAAATGTTAGAAGATGCAAAG pLKO.1 469 CDS 100% 6.000 3.600 N Pfdn4 n/a
9 TRCN0000252942 GAAATGTTAGAAGATGCAAAG pLKO_005 469 CDS 100% 6.000 3.600 N Pfdn4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001110152.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06713 pDONR223 100% 85.8% 97% None (many diffs) n/a
2 ccsbBroad304_06713 pLX_304 0% 85.8% 97% V5 (many diffs) n/a
3 TRCN0000468114 ACCGATCTAACCTAGAGAAATGCA pLX_317 100% 85.8% 97% V5 (many diffs) n/a
Download CSV