Transcript: Mouse NM_001110209.1

Mus musculus lunapark, ER junction formation factor (Lnpk), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Lnpk (69605)
Length:
8775
CDS:
193..1323

Additional Resources:

NCBI RefSeq record:
NM_001110209.1
NBCI Gene record:
Lnpk (69605)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001110209.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000248063 GTGTTAGTAGCACCATATTAA pLKO_005 3531 3UTR 100% 15.000 21.000 N Lnpk n/a
2 TRCN0000248061 ATGAAGCATTGGATGATTTAA pLKO_005 509 CDS 100% 15.000 10.500 N Lnpk n/a
3 TRCN0000248060 ATTATGGGTTGGAAGATTAAT pLKO_005 312 CDS 100% 15.000 10.500 N Lnpk n/a
4 TRCN0000215711 CTTATAAGACAGCTAAGTTAA pLKO.1 575 CDS 100% 13.200 9.240 N Lnpk n/a
5 TRCN0000248059 CTTATAAGACAGCTAAGTTAA pLKO_005 575 CDS 100% 13.200 9.240 N Lnpk n/a
6 TRCN0000215984 CTTTACCTGTTTACCTGTTTA pLKO.1 349 CDS 100% 13.200 9.240 N Lnpk n/a
7 TRCN0000248062 TTTGGTGACAAAGTAGTAAAT pLKO_005 1538 3UTR 100% 13.200 9.240 N Lnpk n/a
8 TRCN0000179684 GCTGATTCTGTTCCTAATCTT pLKO.1 1500 3UTR 100% 5.625 3.938 N Lnpk n/a
9 TRCN0000166364 CACACACACACACACACACAA pLKO.1 8083 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001110209.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12710 pDONR223 100% 50.4% 46.1% None (many diffs) n/a
2 ccsbBroad304_12710 pLX_304 0% 50.4% 46.1% V5 (many diffs) n/a
3 TRCN0000478068 GACAGACTTCTTAGGATCCTTCGA pLX_317 23.2% 50.4% 46.1% V5 (many diffs) n/a
Download CSV