Transcript: Mouse NM_001110274.1

Mus musculus solute carrier family 14 (urea transporter), member 2 (Slc14a2), transcript variant 4, mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Slc14a2 (27411)
Length:
1428
CDS:
245..1216

Additional Resources:

NCBI RefSeq record:
NM_001110274.1
NBCI Gene record:
Slc14a2 (27411)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001110274.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000070316 CGGAGAAGTTAGACTACTACT pLKO.1 447 CDS 100% 4.950 6.930 N Slc14a2 n/a
2 TRCN0000375998 CTACGGGCCACTACAACCTTT pLKO_005 606 CDS 100% 4.950 6.930 N Slc14a2 n/a
3 TRCN0000314126 TGATCCTGGTGGCTCTGTTTA pLKO_005 768 CDS 100% 13.200 9.240 N Slc14a2 n/a
4 TRCN0000350050 TGCGTCTGCAGCTCCCAATAT pLKO_005 652 CDS 100% 13.200 9.240 N Slc14a2 n/a
5 TRCN0000314127 CAAGCAGAAATGCTCTCCTTG pLKO_005 1225 3UTR 100% 4.050 2.835 N Slc14a2 n/a
6 TRCN0000070315 CACAAGCAACAACACTGGCAT pLKO.1 1093 CDS 100% 2.640 1.848 N Slc14a2 n/a
7 TRCN0000070317 GACAGAGATTGAAATGCCTTT pLKO.1 679 CDS 100% 4.050 2.430 N Slc14a2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001110274.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07206 pDONR223 100% 30.1% 30.1% None (many diffs) n/a
2 ccsbBroad304_07206 pLX_304 0% 30.1% 30.1% V5 (many diffs) n/a
3 TRCN0000475534 TTTGGTTTATTTCAGTCCTTCAGC pLX_317 9.9% 30.1% 30.1% V5 (many diffs) n/a
Download CSV