Transcript: Mouse NM_001110794.1

Mus musculus annexin A7 (Anxa7), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Anxa7 (11750)
Length:
2850
CDS:
241..1632

Additional Resources:

NCBI RefSeq record:
NM_001110794.1
NBCI Gene record:
Anxa7 (11750)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001110794.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000307622 GGCCACTATGGAGGCTTATTC pLKO_005 1296 CDS 100% 13.200 18.480 N Anxa7 n/a
2 TRCN0000110716 CGACTCTACTATTCCATGAAA pLKO.1 1435 CDS 100% 5.625 7.875 N Anxa7 n/a
3 TRCN0000288364 CGACTCTACTATTCCATGAAA pLKO_005 1435 CDS 100% 5.625 7.875 N Anxa7 n/a
4 TRCN0000110717 CGCGATTTGCTAAGCAGTGTA pLKO.1 1330 CDS 100% 4.950 6.930 N Anxa7 n/a
5 TRCN0000306713 CGCGATTTGCTAAGCAGTGTA pLKO_005 1330 CDS 100% 4.950 6.930 N Anxa7 n/a
6 TRCN0000295750 AGGAACTCAAGAACGTGTATT pLKO_005 984 CDS 100% 13.200 9.240 N Anxa7 n/a
7 TRCN0000110715 GCCATATCAATGACGTAGTAA pLKO.1 1841 3UTR 100% 5.625 3.938 N Anxa7 n/a
8 TRCN0000288362 GCCATATCAATGACGTAGTAA pLKO_005 1841 3UTR 100% 5.625 3.938 N Anxa7 n/a
9 TRCN0000110718 GCGATTTGCTAAGCAGTGTAA pLKO.1 1331 CDS 100% 4.950 3.465 N Anxa7 n/a
10 TRCN0000110719 CCGCAAAGCAATGAAAGGGTT pLKO.1 747 CDS 100% 2.640 1.848 N Anxa7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001110794.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00072 pDONR223 100% 86.9% 92% None (many diffs) n/a
2 ccsbBroad304_00072 pLX_304 0% 86.9% 92% V5 (many diffs) n/a
3 TRCN0000467745 GCCGATACAAATAATCCAATAGTT pLX_317 24.9% 86.9% 92% V5 (many diffs) n/a
Download CSV