Transcript: Human NM_001111020.3

Homo sapiens SPT5 homolog, DSIF elongation factor subunit (SUPT5H), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-07-23
Taxon:
Homo sapiens (human)
Gene:
SUPT5H (6829)
Length:
3678
CDS:
144..3407

Additional Resources:

NCBI RefSeq record:
NM_001111020.3
NBCI Gene record:
SUPT5H (6829)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001111020.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000019705 GCGAGTATTACATGAAGAAAT pLKO.1 556 CDS 100% 13.200 10.560 N SUPT5H n/a
2 TRCN0000344313 GCGAGTATTACATGAAGAAAT pLKO_005 556 CDS 100% 13.200 10.560 N SUPT5H n/a
3 TRCN0000019704 CCATGTGAAAGACATCGTTAA pLKO.1 1925 CDS 100% 10.800 8.640 N SUPT5H n/a
4 TRCN0000344235 CCATGTGAAAGACATCGTTAA pLKO_005 1925 CDS 100% 10.800 8.640 N SUPT5H n/a
5 TRCN0000374493 AGAAGAACTGGGCGAGTATTA pLKO_005 545 CDS 100% 13.200 9.240 N Supt5 n/a
6 TRCN0000019706 CCCAATCTGTGGACTGTCAAA pLKO.1 672 CDS 100% 4.950 3.465 N SUPT5H n/a
7 TRCN0000344314 CCCAATCTGTGGACTGTCAAA pLKO_005 672 CDS 100% 4.950 3.465 N SUPT5H n/a
8 TRCN0000019707 CTGAGCATTGATGGTGAGGAT pLKO.1 3309 CDS 100% 2.640 1.848 N SUPT5H n/a
9 TRCN0000344236 CTGAGCATTGATGGTGAGGAT pLKO_005 3309 CDS 100% 2.640 1.848 N SUPT5H n/a
10 TRCN0000019708 GCTGATGTTGACGATGAGTAT pLKO.1 381 CDS 100% 4.950 2.970 N SUPT5H n/a
11 TRCN0000344233 GCTGATGTTGACGATGAGTAT pLKO_005 381 CDS 100% 4.950 2.970 N SUPT5H n/a
12 TRCN0000093081 GATGAGGAAGAGGAGGAAGAA pLKO.1 306 CDS 100% 4.950 2.475 Y Gm5518 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001111020.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07018 pDONR223 100% 99.9% 100% None 162C>T;177G>A n/a
2 ccsbBroad304_07018 pLX_304 0% 99.9% 100% V5 162C>T;177G>A n/a
3 TRCN0000469662 CTTCTGCCCTCGCCCGTTAAGGCA pLX_317 11.9% 99.9% 100% V5 162C>T;177G>A n/a
Download CSV