Transcript: Human NM_001111077.2

Homo sapiens ezrin (EZR), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-03
Taxon:
Homo sapiens (human)
Gene:
EZR (7430)
Length:
3052
CDS:
126..1886

Additional Resources:

NCBI RefSeq record:
NM_001111077.2
NBCI Gene record:
EZR (7430)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001111077.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000062460 CCCACGTCTGAGAATCAACAA pLKO.1 938 CDS 100% 4.950 6.930 N EZR n/a
2 TRCN0000381306 CCGTGGGATGCTCAAAGATAA pLKO_005 662 CDS 100% 13.200 10.560 N EZR n/a
3 TRCN0000062461 CGTGGGATGCTCAAAGATAAT pLKO.1 663 CDS 100% 13.200 10.560 N EZR n/a
4 TRCN0000062462 CTCCACTATGTGGATAATAAA pLKO.1 264 CDS 100% 15.000 10.500 N EZR n/a
5 TRCN0000380495 GGCCTGATTCTCGCGATTATT pLKO_005 2089 3UTR 100% 15.000 10.500 N EZR n/a
6 TRCN0000379628 GGGCAACCATGAGTTGTATAT pLKO_005 980 CDS 100% 13.200 9.240 N EZR n/a
7 TRCN0000380178 TGATGCCCTTGGACTGAATAT pLKO_005 785 CDS 100% 13.200 9.240 N EZR n/a
8 TRCN0000062458 CCTGGAAATGTATGGAATCAA pLKO.1 716 CDS 100% 5.625 3.938 N EZR n/a
9 TRCN0000062459 CCAGCCAAATACAACTGGAAA pLKO.1 185 CDS 100% 4.950 3.465 N EZR n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001111077.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01770 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01770 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000480271 TGAGCGGCTGTTCCAGTTAATACA pLX_317 26.8% 100% 100% V5 n/a
Download CSV