Transcript: Mouse NM_001111141.1

Mus musculus SprT-like N-terminal domain (Sprtn), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Sprtn (244666)
Length:
2116
CDS:
273..1766

Additional Resources:

NCBI RefSeq record:
NM_001111141.1
NBCI Gene record:
Sprtn (244666)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001111141.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000268026 TGACTGCGCCAGCGCTTTATA pLKO_005 1854 3UTR 100% 15.000 21.000 N Sprtn n/a
2 TRCN0000283579 TGGGACATCCGCAACCATATC pLKO_005 1466 CDS 100% 10.800 15.120 N Sprtn n/a
3 TRCN0000281657 AGGACTGCTTTGGATACTATC pLKO_005 1545 CDS 100% 10.800 8.640 N Sprtn n/a
4 TRCN0000281681 ATGATACATGCCTACTTATTT pLKO_005 612 CDS 100% 15.000 10.500 N Sprtn n/a
5 TRCN0000268027 GCATCGGCAGTGGAGAATAAA pLKO_005 972 CDS 100% 15.000 10.500 N Sprtn n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001111141.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12763 pDONR223 99% 40.4% 42.2% None (many diffs) n/a
2 ccsbBroad304_12763 pLX_304 0% 40.4% 42.2% V5 (many diffs) n/a
3 TRCN0000468689 AACGATGAAAGACCCATGACACAG pLX_317 55.4% 40.4% 42.2% V5 (many diffs) n/a
Download CSV