Transcript: Mouse NM_001113327.2

Mus musculus family with sequence similarity 131, member B (Fam131b), transcript variant b, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Fam131b (76156)
Length:
4072
CDS:
172..1218

Additional Resources:

NCBI RefSeq record:
NM_001113327.2
NBCI Gene record:
Fam131b (76156)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001113327.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000123851 GCAAGTGATCAGTCCCTCATT pLKO.1 835 CDS 100% 4.950 3.960 N Fam131b n/a
2 TRCN0000317905 GCAAGTGATCAGTCCCTCATT pLKO_005 835 CDS 100% 4.950 3.960 N Fam131b n/a
3 TRCN0000433451 TTCGTCGCGCTGAACACTGAA pLKO_005 1497 3UTR 100% 4.950 3.960 N Fam131b n/a
4 TRCN0000123853 CTACACTTATGGCTTGGTCTT pLKO.1 632 CDS 100% 4.050 3.240 N Fam131b n/a
5 TRCN0000374615 AGCTTAAGCGAAACTCTAATG pLKO_005 344 CDS 100% 10.800 7.560 N Fam131b n/a
6 TRCN0000123849 GCACTCCAGAAACCCGTCATT pLKO.1 1395 3UTR 100% 4.950 3.465 N Fam131b n/a
7 TRCN0000123850 GCTCCAACAATTCAGCCACAA pLKO.1 499 CDS 100% 4.050 2.835 N Fam131b n/a
8 TRCN0000317902 GCTCCAACAATTCAGCCACAA pLKO_005 499 CDS 100% 4.050 2.835 N Fam131b n/a
9 TRCN0000123852 GCAGGTGTCATGGAACAGTTT pLKO.1 598 CDS 100% 4.950 2.970 N Fam131b n/a
10 TRCN0000317833 GCAGGTGTCATGGAACAGTTT pLKO_005 598 CDS 100% 4.950 2.970 N Fam131b n/a
11 TRCN0000074324 CCGAAGCTTAAGCGAAACTTT pLKO.1 340 CDS 100% 5.625 3.938 N FAM131B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001113327.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07472 pDONR223 100% 86.9% 91.6% None (many diffs) n/a
2 ccsbBroad304_07472 pLX_304 0% 86.9% 91.6% V5 (many diffs) n/a
Download CSV